diff --git a/README.md b/README.md index 55fdf8d..4937793 100644 --- a/README.md +++ b/README.md @@ -1,7 +1,7 @@ # Automated Retrieval of Orthologous DNA Sequences from GenBank [![Build Status](https://travis-ci.org/ropensci/phylotaR.svg?branch=master)](https://travis-ci.org/ropensci/phylotaR) [![Coverage Status](https://coveralls.io/repos/github/ropensci/phylotaR/badge.svg?branch=master)](https://coveralls.io/github/ropensci/phylotaR?branch=master) [![](https://badges.ropensci.org/187_status.svg)](https://github.com/ropensci/onboarding/issues/187) [![CRAN downloads](http://cranlogs.r-pkg.org/badges/grand-total/phylotaR)](https://CRAN.R-project.org/package=phylotaR) -R implementation of the [PhyLoTa sequence cluster pipeline](http://phylota.net/). For more information see the accompanying website. Tested and demonstrated on Unix and Windows. **Find out more by visiting the [phylotaR website](https://ropensci.github.io/phylotaR/).** +R implementation of the PhyLoTa sequence cluster pipeline. For more information see the accompanying website. Tested and demonstrated on Unix and Windows. **Find out more by visiting the [phylotaR website](https://ropensci.github.io/phylotaR/).** ## Install From CRAN: diff --git a/docs/CONTRIBUTING.html b/docs/CONTRIBUTING.html deleted file mode 100644 index 78375e1..0000000 --- a/docs/CONTRIBUTING.html +++ /dev/null @@ -1,195 +0,0 @@ - - - - - - - - -CONTRIBUTING • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-
- - - -
- -
-
-
-

CONTRIBUTING

-
- -
- -
-

-Fixing typos

-

Small typos or grammatical errors in documentation may be edited directly using the GitHub web interface, so long as the changes are made in the source file.

-
    -
  • YES: you edit a roxygen comment in a .R file below R/.
    • -
  • NO: you edit an .Rd file below man/.
    • -
-
-
-

-Prerequisites

-

Before you make a substantial pull request, you should always file an issue and make sure someone from the team agrees that it’s a problem. If you’ve found a bug, create an associated issue and illustrate the bug with a minimal reprex.

-
-
-

-Pull request process

-
    -
  • We recommend that you create a Git branch for each pull request (PR).
    -
    • -
  • Look at the Travis and AppVeyor build status before and after making changes. The README should contain badges for any continuous integration services used by the package.
    -
    • -
  • We recommend the tidyverse style guide. You can use the styler package to apply these styles, but please don’t restyle code that has nothing to do with your PR.
    -
    • -
  • We use roxygen2.
    -
    • -
  • We use testthat. Contributions with test cases included are easier to accept.
    -
    • -
  • For user-facing changes, add a bullet to the top of NEWS.md below the current development version header describing the changes made followed by your GitHub username, and links to relevant issue(s)/PR(s).
    • -
-
-
-

-Code of Conduct

-

Please note that the phylotaR project is released with a Contributor Code of Conduct. By contributing to this project you agree to abide by its terms.

-
-
-

-See rOpenSci contributing guide -

-

for further details.

-
-
-

-Discussion forum

-

Check out our discussion forum if you think your issue requires a longer form discussion.

-
-
-

-Prefer to Email?

-

Email the person listed as maintainer in the DESCRIPTION file of this repo.

-

Though note that private discussions over email don’t help others - of course email is totally warranted if it’s a sensitive problem of any kind.

-
-
-

-Thanks for contributing!

-

This contributing guide is adapted from the tidyverse contributing guide available at https://raw.githubusercontent.com/r-lib/usethis/master/inst/templates/tidy-contributing.md

-
-
- -
- -
- - - -
- - - - - - diff --git a/docs/LICENSE-text.html b/docs/LICENSE-text.html deleted file mode 100644 index 039a124..0000000 --- a/docs/LICENSE-text.html +++ /dev/null @@ -1,137 +0,0 @@ - - - - - - - - -License • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-
- - - -
- -
-
-
-

License

-
- -
YEAR: 2018
-COPYRIGHT HOLDER: Antonelli Lab
-
- -
- -
- - - -
- - - - - - diff --git a/docs/apple-touch-icon-120x120.png b/docs/apple-touch-icon-120x120.png deleted file mode 100644 index a1bd7de..0000000 Binary files a/docs/apple-touch-icon-120x120.png and /dev/null differ diff --git a/docs/apple-touch-icon-152x152.png b/docs/apple-touch-icon-152x152.png deleted file mode 100644 index cae4bc5..0000000 Binary files a/docs/apple-touch-icon-152x152.png and /dev/null differ diff --git a/docs/apple-touch-icon-180x180.png b/docs/apple-touch-icon-180x180.png deleted file mode 100644 index 89a45ff..0000000 Binary files a/docs/apple-touch-icon-180x180.png and /dev/null differ diff --git a/docs/apple-touch-icon-60x60.png b/docs/apple-touch-icon-60x60.png deleted file mode 100644 index 3a88ead..0000000 Binary files a/docs/apple-touch-icon-60x60.png and /dev/null differ diff --git a/docs/apple-touch-icon-76x76.png b/docs/apple-touch-icon-76x76.png deleted file mode 100644 index 0332f1e..0000000 Binary files a/docs/apple-touch-icon-76x76.png and /dev/null differ diff --git a/docs/apple-touch-icon.png b/docs/apple-touch-icon.png deleted file mode 100644 index 4e920d8..0000000 Binary files a/docs/apple-touch-icon.png and /dev/null differ diff --git a/docs/articles/index.html b/docs/articles/index.html deleted file mode 100644 index 75613e5..0000000 --- a/docs/articles/index.html +++ /dev/null @@ -1,144 +0,0 @@ - - - - - - - - -Articles • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-
- - - -
- -
-
-
-

Articles

-
- -
-

All vignettes

-

- - -
-
-
- - -
- - - - - - diff --git a/docs/articles/phylotaR-advanced.html b/docs/articles/phylotaR-advanced.html deleted file mode 100644 index f9d9273..0000000 --- a/docs/articles/phylotaR-advanced.html +++ /dev/null @@ -1,133 +0,0 @@ - - - - - - - -phylotaR Advanced • phylotaR - - - - - - - - - -
-
- - - -
-
-
-

phylotaR Advanced

-

D.J. Bennett

- -

2018-06-15

- - Source: vignettes/phylotaR-advanced.Rmd - - -
- - - -

Sorry… haven’t written much here.

-
-

-Parameters

-
-
-

-Taxonomic FTP

-
-
- - - -
- - - -
- - - - - diff --git a/docs/articles/phylotaR.html b/docs/articles/phylotaR.html deleted file mode 100644 index e9ec7aa..0000000 --- a/docs/articles/phylotaR.html +++ /dev/null @@ -1,256 +0,0 @@ - - - - - - - -phylotaR Tutorial • phylotaR - - - - - - - - - - - - - - - - -
-
- - - -
-
-
-

phylotaR Tutorial

- - - Source: vignettes/phylotaR.Rmd - - -
- - - -
-

-Introduction

-

The first step to running a phylogenetic analysis is the identification of overlapping sequences. Often orthology is determined by pairing sequences whose gene names match (e.g. COI sequences with COI sequences, rbcl sequences with rbcl sequences). Problems can arise however if gene names differ between authors, if different gene sections are represented or if sequences are mislabelled. These issues can be especially problematic for large-scale analyses where individual errors cannot be detected.

-

PhyLoTa is a pipeline that uses an alignment search tool to identify orthologous sequences without the need for gene name matching. For a given parental taxonomic group, the pipeline will search through available sequences hosted on GenBank and identify orthologous sequence clusters. A user is then able to survey the identified clusters and select the ones which best suit their phylogenetic analysis needs, e.g. by selecting the clusters that maximise the number of taxonomic groups.

-

This R pacakge, phylotaR, is an R implementation of this pipeline. In this vignette we will demonstrate how to run PhyLoTa using a small taxonomic group. The pipeline is composed of four automated stages (taxise, download, cluster, cluster2) and a final user-performed stage of cluster selection.

-
-
-

-Installing NCBI BLAST+ Tools

-

The PhyLoTa pipeline uses BLAST to identify orthologous sequence clusters. In order to run phylotaR, a local copy of the BLAST software must be installed on your computer. Installing the phylotaR package does not install BLAST, it must be installed separately. To install BLAST+, please see the NCBI website’s installation instructions.

-
-
-

-Pipeline

-
-

-Setup

-

For demonstration purposes we will run the pipeline on a small taxonomic group. Because they are charismatic and relatively well-studied, we will select the Night Monkey genus, Aotus. Now that we have decided on a taxonomic group we need to find out its unique taxonomic ID. This can be looked up by navigating to the NCBI taxonomy webpage and searching ‘Aotus’. Doing this, we can see that Aotus ID is 9504. We will need this number for specifying the parameters in our pipeline. (Notice, that there is also a plant genus called Aotus.)

-

To begin a run, we will need to create a new folder that will contain all the output files generated by the phylotaR pipeline. Since we are running the analysis on the Aotus genus, let’s call the folder aotus/. Now we have our working directory folder created, we can now open R and run the following code.

-
library(phylotaR)
-wd <- '[YOUR PATH TO AOTUS FOLDER]'
-ncbi_dr <- '[YOUR PATH TO NCBI BLAST TOOLS]'
-txid <- 9504
-setup(wd = wd, txid = txid, ncbi_dr = ncbi_dr, v = TRUE)
-

The above imports the phylotaR package and initiates a cache that will contain the pipeline parameters. For this tutorial we will keep the parameters as their default. See the function parameters() for a complete list and description of all the parameters and their default values. For more detailed information on the parameters please see the publication, phylotaR: An Automated Pipeline for Retrieving Orthologous DNA Sequences from GenBank in R. wd must be a file path to the folder we called aotus/. ncbi_dr must be a file path to the folder containing all the NCBI BLAST+ tools – see above ‘Installing NCBI BLAST+ Tools’. Depending on your system and how you installed the tools, they may be in your system path in which case you can simply supply ‘.’ to the ncbi_dr argument. On my computer I provide the path to the where the blastn executable is located, e.g. /usr/local/ncbi/blast/bin/. Running setup() will verify whether the BLAST tools are installed correctly.

-
-
-

-Running

-

After setup() has been run we can run the pipeline with the following command.

-
run(wd = wd)
-

This will run all the automated stages of the pipeline: taxise, download, cluster and cluster2. The first of these stages looks up all the taxonomic information available on the descendants of the parent ID provided, txid. The second downloads representative sequences for all identified descendants. No additional arguments are required other than wd which specifies the working directory that contains the cache and all parameters as set up by setup(). In this folder you will also find a log.txt that reports detailed information on the progression of the pipeline as well as all the output files generated by each stage. Additionally, you will see session info and a blast version text files. These files, along with the log, can help debugging if any errors occur. The whole pipeline can complete in around 2 minutes for Aotus using default parameters. Aotus, however, is a genus of only 13 taxa, larger clades will take much longer particularly during the download stage.

-
-
-

-Restarting

-

The pipeline can be halted and restarted. The cache records all downloaded and generated data by the pipeline. If there is a system crash or the user wishes to halt the program, the pipeline can be restarted from the same point it stopped with the function restart(). Additionally, due to the potential random nature of the pipeline, a user may wish to re-run the pipeline from certain stages. This can be achived by first using reset() followed by restart(). For example, in the code below a completed pipeline is reset to ‘cluster’ and then restarted. After running these commands, the pipeline will run as if it has only just completed the download stage. Note, all resets and restarts are recorded in the log.

-
reset(wd = wd, stage = 'cluster')
-restart(wd = wd)
-
-

-Changing parameters

-

Paramaters can always be set by a user at the initiation of a folder with the setup() function. To change the parameter values after a folder has already been set up, a user can use parameters_reset(). For example, if the download stage is taking particularly long, the btchsz could be increased. This would raise the number of sequences downloaded per request. (Note, too high a btchsz may cause your NCBI Entrez access being limited.)

-
# use ctrl+c or Esc to halt R
-# increase the btchsz from the default to 300
-parameters_reset(wd = wd, parameters = 'btchz', values = 300)
-restart(wd = wd)
-# ^ restart from whatever point it was halted
-
-
-
-

-Cluster selection

-

After a pipeline has completed, the identified clusters can be interrogated. We can generate a phylota object using read_phylota() but in the code below we will load a pre-existing phylota object from the package data. The phylota object contains cluster, sequence and taxonomic information on all the clusters. It has 6 data slots: cids, sids, txids, txdct, sqs, clstrs, prnt_id and prnt_nm. Each of these slots can be accessed with @, see ?`Phylota-class` for more information. The phylotaR package has a range of functions for probing clusters in a phylota object. For example, if we want to know how many different taxonomic groups are represented by each cluster we can use get_ntaxa().

-
library(phylotaR)
-# pre-load already run aotus from package data
-data('aotus')
-all_clusters <- aotus
-print(all_clusters)
-
## [1] "Phylota Table (Aotus)\n- [193] clusters\n- [1499] sequences\n- [13] source taxa\n"
-
# otherwise, run:
-# all_clusters <- read_phylota(wd)
-cids <- all_clusters@cids
-n_taxa <- get_ntaxa(phylota = all_clusters, cid = cids)
-

We can then drop all the clusters with fewer than 6 taxa and create a new phylota object using the drop_cls() function. Let’s then take a peak of the now smaller object’s clusters using summary().

-
keep <- cids[n_taxa > 6]
-selected <- drop_clstrs(phylota = all_clusters, cid = keep)
-smmry <- summary(selected)
-print(smmry)
-
##   ID    Type                Seed Parent N_taxa N_seqs Med_sql       MAD
-## 1  4 subtree            U36844.1   9504      9     41     549 0.8397112
-## 2  9 subtree          AJ489745.1   9504     10     29    1140 1.0000000
-## 3 29 subtree AF338374.1/177..829   9504      8     10     653 0.9658499
-##                        Definition                      Feature
-## 1 gene (0.1), mitochondrial (0.1)                     coii (1)
-## 2   aotus (0.1), cytochrome (0.1) cytb (0.4), cytochrome (0.3)
-## 3          sry (0.2), aotus (0.1)                      sry (1)
-

This summary provides information on each cluster in the phylota object, such as median sequence length, MAD score (the mean alignment density, values closer to 1 indicate all the sequences are of a similar length), most common words in the sequence descriptions and feature names. Let’s select the second ID in this table for further investigation. We can extract its cluster and sequences records in the following way.

-
cid <- smmry[2, 'ID']
-# get the cluster record
-cluster_record <- selected@clstrs[[cid]]
-# use the seq. IDs to get the sequence records
-seq_records <- selected@sqs[cluster_record@sids]
-# extract a single record
-seq_record <- seq_records[[seq_records@ids[[1]]]]
-summary(seq_record)
-
## SeqRec [ID: AJ489745.1]
-
# get the sequence
-seq <- rawToChar(seq_record@sq)
-print(substr(x = seq, start = 1, stop = 80))
-
## [1] "atgacttctccccgcaaaacacacccactaacaaagatcattaacgaatcattcattgatctacccacaccacccaacat"
-

We could extract and write out each of the sequences for a cluster in the above manner. Handily, however, phylotaR comes with some tools to make outputting sequences easier. First because there are multiple sequences per taxon, we need to select a single representative sequence. We can do this with the drop_by_rank() function. With this function we choose a taxonomic rank at which we would like our sequences to be represented. The function then chooses the ‘best’ sequence representing each taxon for that rank using a range of criteria. With this new phylota object, we can then extract the scientific names and write out the sequences.

-
# choose best sequence per species
-reduced <- drop_by_rank(phylota = selected, rnk = 'species', n = 1)
-# get txids at the species level for each sequence
-txids <- get_txids(phylota = reduced, cid = cid, rnk = 'species')
-# look up name for txids
-scientific_names <- get_tx_slot(phylota = reduced, txid = txids, slt_nm = 'scnm')
-# clean the names
-scientific_names <- gsub('\\.', '', scientific_names)
-scientific_names <- gsub('\\s+', '_', scientific_names)
-print(scientific_names)
-
##           AJ489745.1           DQ098865.1           DQ098869.1 
-##    "Aotus_nancymaae"       "Aotus_azarai" "Aotus_griseimembra" 
-##           DQ098873.1           HQ005497.1           HQ005502.1 
-##  "Aotus_trivirgatus"    "Aotus_nigriceps"   "Aotus_vociferans" 
-##           HQ005506.1   KR528418.1/1..1140 
-##    "Aotus_lemurinus"           "Aotus_sp"
-
# look up sequence IDs for our chosen cluster
-sids <- reduced@clstrs[[cid]]@sids
-# write out
-write_sqs(phylota = reduced, sid = sids, sq_nm = scientific_names,
-          outfile = file.path(tempdir(), 'cytb.fasta'))
-# ^ to avoid clutter, we're writing to a temporary folder
-
-
-

-Testing output

-

We can sanity check our cluster sequences by running a very quick phylogenetic analysis using mafft and raxml. The below code will use the cluster to generate an alignment and a tree through R. In order for the code to run, it requires the installation of mafft and raxml and, additionally, may require tweaking to work on your system.

-
library(ape)
-system('mafft --auto cytb.fasta > alignment.fasta')
-system(paste0('raxmlHPC -m GTRGAMMA -f a -N 10 -p 1234 -x 1234 -n aotus -s alignment.fasta'))
-tree <- read.tree(file = 'RAxML_bestTree.aotus')
-plot(tree, no.margin = TRUE, type = 'unrooted')
-
-
-
- - - -
- - - -
- - - - - diff --git a/docs/authors.html b/docs/authors.html deleted file mode 100644 index 89e8938..0000000 --- a/docs/authors.html +++ /dev/null @@ -1,156 +0,0 @@ - - - - - - - - -Authors • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-
- - - -
- -
-
-
-

Authors

-
- -
    -
  • -

    Hannes Hettling. Author. -

    -
    • -
  • -

    Rutger Vos. Author. -

    -
    • -
  • -

    Alexander Zizka. Author. -

    -
    • -
  • -

    Dom Bennett. Author, maintainer. -

    -
    • -
  • -

    Alexandre Antonelli. Author. -

    -
    • -
- -
- -
- - - -
- - - - - - diff --git a/docs/docsearch.css b/docs/docsearch.css deleted file mode 100644 index e5f1fe1..0000000 --- a/docs/docsearch.css +++ /dev/null @@ -1,148 +0,0 @@ -/* Docsearch -------------------------------------------------------------- */ -/* - Source: https://github.com/algolia/docsearch/ - License: MIT -*/ - -.algolia-autocomplete { - display: block; - -webkit-box-flex: 1; - -ms-flex: 1; - flex: 1 -} - -.algolia-autocomplete .ds-dropdown-menu { - width: 100%; - min-width: none; - max-width: none; - padding: .75rem 0; - background-color: #fff; - background-clip: padding-box; - border: 1px solid rgba(0, 0, 0, .1); - box-shadow: 0 .5rem 1rem rgba(0, 0, 0, .175); -} - -@media (min-width:768px) { - .algolia-autocomplete .ds-dropdown-menu { - width: 175% - } -} - -.algolia-autocomplete .ds-dropdown-menu::before { - display: none -} - -.algolia-autocomplete .ds-dropdown-menu [class^=ds-dataset-] { - padding: 0; - background-color: rgb(255,255,255); - border: 0; - max-height: 80vh; -} - -.algolia-autocomplete .ds-dropdown-menu .ds-suggestions { - margin-top: 0 -} - -.algolia-autocomplete .algolia-docsearch-suggestion { - padding: 0; - overflow: visible -} - -.algolia-autocomplete .algolia-docsearch-suggestion--category-header { - padding: .125rem 1rem; - margin-top: 0; - font-size: 1.3em; - font-weight: 500; - color: #00008B; - border-bottom: 0 -} - -.algolia-autocomplete .algolia-docsearch-suggestion--wrapper { - float: none; - padding-top: 0 -} - -.algolia-autocomplete .algolia-docsearch-suggestion--subcategory-column { - float: none; - width: auto; - padding: 0; - text-align: left -} - -.algolia-autocomplete .algolia-docsearch-suggestion--content { - float: none; - width: auto; - padding: 0 -} - -.algolia-autocomplete .algolia-docsearch-suggestion--content::before { - display: none -} - -.algolia-autocomplete .ds-suggestion:not(:first-child) .algolia-docsearch-suggestion--category-header { - padding-top: .75rem; - margin-top: .75rem; - border-top: 1px solid rgba(0, 0, 0, .1) -} - -.algolia-autocomplete .ds-suggestion .algolia-docsearch-suggestion--subcategory-column { - display: block; - padding: .1rem 1rem; - margin-bottom: 0.1; - font-size: 1.0em; - font-weight: 400 - /* display: none */ -} - -.algolia-autocomplete .algolia-docsearch-suggestion--title { - display: block; - padding: .25rem 1rem; - margin-bottom: 0; - font-size: 0.9em; - font-weight: 400 -} - -.algolia-autocomplete .algolia-docsearch-suggestion--text { - padding: 0 1rem .5rem; - margin-top: -.25rem; - font-size: 0.8em; - font-weight: 400; - line-height: 1.25 -} - -.algolia-autocomplete .algolia-docsearch-footer { - width: 110px; - height: 20px; - z-index: 3; - margin-top: 10.66667px; - float: right; - font-size: 0; - line-height: 0; -} - -.algolia-autocomplete .algolia-docsearch-footer--logo { - background-image: url("data:image/svg+xml;utf8,"); - background-repeat: no-repeat; - background-position: 50%; - background-size: 100%; - overflow: hidden; - text-indent: -9000px; - width: 100%; - height: 100%; - display: block; - transform: translate(-8px); -} - -.algolia-autocomplete .algolia-docsearch-suggestion--highlight { - color: #FF8C00; - background: rgba(232, 189, 54, 0.1) -} - - -.algolia-autocomplete .algolia-docsearch-suggestion--text .algolia-docsearch-suggestion--highlight { - box-shadow: inset 0 -2px 0 0 rgba(105, 105, 105, .5) -} - -.algolia-autocomplete .ds-suggestion.ds-cursor .algolia-docsearch-suggestion--content { - background-color: rgba(192, 192, 192, .15) -} diff --git a/docs/docsearch.js b/docs/docsearch.js deleted file mode 100644 index b35504c..0000000 --- a/docs/docsearch.js +++ /dev/null @@ -1,85 +0,0 @@ -$(function() { - - // register a handler to move the focus to the search bar - // upon pressing shift + "/" (i.e. "?") - $(document).on('keydown', function(e) { - if (e.shiftKey && e.keyCode == 191) { - e.preventDefault(); - $("#search-input").focus(); - } - }); - - $(document).ready(function() { - // do keyword highlighting - /* modified from https://jsfiddle.net/julmot/bL6bb5oo/ */ - var mark = function() { - - var referrer = document.URL ; - var paramKey = "q" ; - - if (referrer.indexOf("?") !== -1) { - var qs = referrer.substr(referrer.indexOf('?') + 1); - var qs_noanchor = qs.split('#')[0]; - var qsa = qs_noanchor.split('&'); - var keyword = ""; - - for (var i = 0; i < qsa.length; i++) { - var currentParam = qsa[i].split('='); - - if (currentParam.length !== 2) { - continue; - } - - if (currentParam[0] == paramKey) { - keyword = decodeURIComponent(currentParam[1].replace(/\+/g, "%20")); - } - } - - if (keyword !== "") { - $(".contents").unmark({ - done: function() { - $(".contents").mark(keyword); - } - }); - } - } - }; - - mark(); - }); -}); - -/* Search term highlighting ------------------------------*/ - -function matchedWords(hit) { - var words = []; - - var hierarchy = hit._highlightResult.hierarchy; - // loop to fetch from lvl0, lvl1, etc. - for (var idx in hierarchy) { - words = words.concat(hierarchy[idx].matchedWords); - } - - var content = hit._highlightResult.content; - if (content) { - words = words.concat(content.matchedWords); - } - - // return unique words - var words_uniq = [...new Set(words)]; - return words_uniq; -} - -function updateHitURL(hit) { - - var words = matchedWords(hit); - var url = ""; - - if (hit.anchor) { - url = hit.url_without_anchor + '?q=' + escape(words.join(" ")) + '#' + hit.anchor; - } else { - url = hit.url + '?q=' + escape(words.join(" ")); - } - - return url; -} diff --git a/docs/favicon-16x16.png b/docs/favicon-16x16.png deleted file mode 100644 index 145d9d0..0000000 Binary files a/docs/favicon-16x16.png and /dev/null differ diff --git a/docs/favicon-32x32.png b/docs/favicon-32x32.png deleted file mode 100644 index a8d8316..0000000 Binary files a/docs/favicon-32x32.png and /dev/null differ diff --git a/docs/favicon.ico b/docs/favicon.ico deleted file mode 100644 index 9a22739..0000000 Binary files a/docs/favicon.ico and /dev/null differ diff --git a/docs/index.html b/docs/index.html deleted file mode 100644 index 5d09e58..0000000 --- a/docs/index.html +++ /dev/null @@ -1,331 +0,0 @@ - - - - - - - -Automated Phylogenetic Sequence Cluster Identification from 'GenBank' • phylotaR - - - - - - - - - - - -
-
- - - -
-
-
-

-Automated Retrieval of Orthologous DNA Sequences from GenBank -

- -

R implementation of the PhyLoTa sequence cluster pipeline. For more information see the accompanying website. Tested and demonstrated on Unix and Windows. Find out more by visiting the phylotaR website.

-
-

-Install

-

From CRAN:

-
install.packages('phylotaR')
-

Or, download the development package from GitHub:

-
devtools::install_github(repo='ropensci/phylotaR', build_vignettes=TRUE)
-

Full functionality depends on a local copy of BLAST+ (>= 2.0.0). For details on downloading and compiling BLAST+ on your machine please visit the NCBI website.

-
-
-

-Pipeline

-

phylotaR runs the PhyLoTa pipeline in four automated stages: identify and retrieve taxonomic information on all descendent nodes of the taxonomic group of interest (taxise), download sequence data for every identified node (download), identify orthologous clusters using BLAST (cluster), and identify sister clusters for sets of clusters identified in the previous stage (cluster^2) After these stages are complete, phylotaR provides tools for exploring, identifying and exporting suitable clusters for subsequent analysis.

-

phylotaR pipeline

-

For more information on the pipeline and how it works see the publication, phylotaR: An Automated Pipeline for Retrieving Orthologous DNA Sequences from GenBank in R.

-
-
-

-Running

-

At a minimum all a user need do is provide the taxonomic ID of their chosen taxonomic group of interest. For example, if you were interested in primates, you can visit the NCBI taxonomy home page and search primates to look up their ID. After identifying the ID, the phylotaR pipeline can be run with the following script.

-
library(phylotaR)
-wd <- '[FILEPATH TO WORKING DIRECTORY]'
-ncbi_dr <- '[FILEPATH TO COMPILED BLAST+ TOOLS]'
-txid <- 9443  # primates ID
-setup(wd = wd, txid = txid, ncbi_dr = ncbi_dr)
-run(wd = wd)
-

The pipeline can be stopped and restarted at any point without loss of data. For more details on this script, how to change parameters, check the log and details of the pipeline, please check out the package vignette.

-
library(phylotaR)
-vignette("phylotaR")
-
-
-

-Timings

-

How long does it take for a phylotaR pipeline to complete? Below is a table listing the runtimes in minutes for different demonstration, taxonomic groups.

- ----------- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
TaxonN. taxaN. sequencesN. clustersTaxise (mins.)Download (mins.)Cluster (mins.)Cluster2 (mins.)Total (mins.)
Anisoptera1175114327961.623480.01772
Acipenseridae5124073330.16.96.40.01713
Tinamiformes25251980.0672.40.180.0172.7
Aotus1314991930.0673.20.603.9
Bromeliaceae117198337241.228370.03366
Cycadidae35383315400.3219180.03337
Eutardigrada2619602110.3111.80.0514
Kazachstania406231010.12030.0523
Platyrrhini2121273131120.35516.91.260
-

To run these same demonstrations see demos/demo_run.R.

-
-
-

-License

-

MIT

-
-
-

-Version

-

Version 1.

-
-
-

-Authors

-

Dom Bennett (maintainer, R package dev), Hannes Hettling (workhouse code dev), Rutger Vos, Alexander Zizka and Alexandre Antonelli

-
-
-

-Reference

-

Bennett, D., Hettling, H., Silvestro, D., Zizka, A., Bacon, C., Faurby, S., … Antonelli, A. (2018). phylotaR: An Automated Pipeline for Retrieving Orthologous DNA Sequences from GenBank in R. Life, 8(2), 20. DOI:10.3390/life8020020

-

Sanderson, M. J., Boss, D., Chen, D., Cranston, K. A., & Wehe, A. (2008). The PhyLoTA Browser: Processing GenBank for molecular phylogenetics research. Systematic Biology, 57(3), 335–346. DOI:10.1080/10635150802158688

-
-

ropensci_footer

-
-
-
- - -
- - - -
- - - - - diff --git a/docs/issue_template.html b/docs/issue_template.html deleted file mode 100644 index 96ca713..0000000 --- a/docs/issue_template.html +++ /dev/null @@ -1,139 +0,0 @@ - - - - - - - - -NA • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-
- - - -
- -
-
-
-

NA

-
- - -

Session Info

-
-

- - -
- -
- - - -
- - - - - - diff --git a/docs/link.svg b/docs/link.svg deleted file mode 100644 index 88ad827..0000000 --- a/docs/link.svg +++ /dev/null @@ -1,12 +0,0 @@ - - - - - - diff --git a/docs/logo.png b/docs/logo.png deleted file mode 100644 index f095547..0000000 Binary files a/docs/logo.png and /dev/null differ diff --git a/docs/news/index.html b/docs/news/index.html deleted file mode 100644 index 7b2c4cc..0000000 --- a/docs/news/index.html +++ /dev/null @@ -1,166 +0,0 @@ - - - - - - - - -Changelog • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-
- - - -
- -
-
-
-

Changelog

- Source: NEWS.md -
- -
-

-phylotaR 1.1.0 Unreleased -

-
-

-restez integration

- -
-
-
-

-phylotaR 1.0.0 2018-07-31 -

-
-
- - - -
- - -
- - - - - - diff --git a/docs/pkgdown.css b/docs/pkgdown.css deleted file mode 100644 index 2e4f0cf..0000000 --- a/docs/pkgdown.css +++ /dev/null @@ -1,236 +0,0 @@ -/* Sticky footer */ - -/** - * Basic idea: https://philipwalton.github.io/solved-by-flexbox/demos/sticky-footer/ - * Details: https://github.com/philipwalton/solved-by-flexbox/blob/master/assets/css/components/site.css - * - * .Site -> body > .container - * .Site-content -> body > .container .row - * .footer -> footer - * - * Key idea seems to be to ensure that .container and __all its parents__ - * have height set to 100% - * - */ - -html, body { - height: 100%; -} - -body > .container { - display: flex; - height: 100%; - flex-direction: column; - - padding-top: 60px; -} - -body > .container .row { - flex: 1 0 auto; -} - -footer { - margin-top: 45px; - padding: 35px 0 36px; - border-top: 1px solid #e5e5e5; - color: #666; - display: flex; - flex-shrink: 0; -} -footer p { - margin-bottom: 0; -} -footer div { - flex: 1; -} -footer .pkgdown { - text-align: right; -} -footer p { - margin-bottom: 0; -} - -img.icon { - float: right; -} - -img { - max-width: 100%; -} - -/* Fix bug in bootstrap (only seen in firefox) */ -summary { - display: list-item; -} - -/* Typographic tweaking ---------------------------------*/ - -.contents h1.page-header { - margin-top: calc(-60px + 1em); -} - -/* Section anchors ---------------------------------*/ - -a.anchor { - margin-left: -30px; - display:inline-block; - width: 30px; - height: 30px; - visibility: hidden; - - background-image: url(./link.svg); - background-repeat: no-repeat; - background-size: 20px 20px; - background-position: center center; -} - -.hasAnchor:hover a.anchor { - visibility: visible; -} - -@media (max-width: 767px) { - .hasAnchor:hover a.anchor { - visibility: hidden; - } -} - - -/* Fixes for fixed navbar --------------------------*/ - -.contents h1, .contents h2, .contents h3, .contents h4 { - padding-top: 60px; - margin-top: -40px; -} - -/* Static header placement on mobile devices */ -@media (max-width: 767px) { - .navbar-fixed-top { - position: absolute; - } - .navbar { - padding: 0; - } -} - - -/* Sidebar --------------------------*/ - -#sidebar { - margin-top: 30px; -} -#sidebar h2 { - font-size: 1.5em; - margin-top: 1em; -} - -#sidebar h2:first-child { - margin-top: 0; -} - -#sidebar .list-unstyled li { - margin-bottom: 0.5em; -} - -.orcid { - height: 16px; - vertical-align: middle; -} - -/* Reference index & topics ----------------------------------------------- */ - -.ref-index th {font-weight: normal;} - -.ref-index td {vertical-align: top;} -.ref-index .icon {width: 40px;} -.ref-index .alias {width: 40%;} -.ref-index-icons .alias {width: calc(40% - 40px);} -.ref-index .title {width: 60%;} - -.ref-arguments th {text-align: right; padding-right: 10px;} -.ref-arguments th, .ref-arguments td {vertical-align: top;} -.ref-arguments .name {width: 20%;} -.ref-arguments .desc {width: 80%;} - -/* Nice scrolling for wide elements --------------------------------------- */ - -table { - display: block; - overflow: auto; -} - -/* Syntax highlighting ---------------------------------------------------- */ - -pre { - word-wrap: normal; - word-break: normal; - border: 1px solid #eee; -} - -pre, code { - background-color: #f8f8f8; - color: #333; -} - -pre code { - overflow: auto; - word-wrap: normal; - white-space: pre; -} - -pre .img { - margin: 5px 0; -} - -pre .img img { - background-color: #fff; - display: block; - height: auto; -} - -code a, pre a { - color: #375f84; -} - -a.sourceLine:hover { - text-decoration: none; -} - -.fl {color: #1514b5;} -.fu {color: #000000;} /* function */ -.ch,.st {color: #036a07;} /* string */ -.kw {color: #264D66;} /* keyword */ -.co {color: #888888;} /* comment */ - -.message { color: black; font-weight: bolder;} -.error { color: orange; font-weight: bolder;} -.warning { color: #6A0366; font-weight: bolder;} - -/* Clipboard --------------------------*/ - -.hasCopyButton { - position: relative; -} - -.btn-copy-ex { - position: absolute; - right: 0; - top: 0; - visibility: hidden; -} - -.hasCopyButton:hover button.btn-copy-ex { - visibility: visible; -} - -/* mark.js ----------------------------*/ - -mark { - background-color: rgba(255, 255, 51, 0.5); - border-bottom: 2px solid rgba(255, 153, 51, 0.3); - padding: 1px; -} - -/* vertical spacing after htmlwidgets */ -.html-widget { - margin-bottom: 10px; -} diff --git a/docs/pkgdown.js b/docs/pkgdown.js deleted file mode 100644 index 706ad58..0000000 --- a/docs/pkgdown.js +++ /dev/null @@ -1,110 +0,0 @@ -/* http://gregfranko.com/blog/jquery-best-practices/ */ -(function($) { - $(function() { - - $("#sidebar") - .stick_in_parent({offset_top: 40}) - .on('sticky_kit:bottom', function(e) { - $(this).parent().css('position', 'static'); - }) - .on('sticky_kit:unbottom', function(e) { - $(this).parent().css('position', 'relative'); - }); - - $('body').scrollspy({ - target: '#sidebar', - offset: 60 - }); - - $('[data-toggle="tooltip"]').tooltip(); - - var cur_path = paths(location.pathname); - var links = $("#navbar ul li a"); - var max_length = -1; - var pos = -1; - for (var i = 0; i < links.length; i++) { - if (links[i].getAttribute("href") === "#") - continue; - var nav_path = paths(links[i].pathname); - - var length = prefix_length(nav_path, cur_path); - if (length > max_length) { - max_length = length; - pos = i; - } - } - - // Add class to parent
  • , and enclosing
  • if in dropdown - if (pos >= 0) { - var menu_anchor = $(links[pos]); - menu_anchor.parent().addClass("active"); - menu_anchor.closest("li.dropdown").addClass("active"); - } - }); - - function paths(pathname) { - var pieces = pathname.split("/"); - pieces.shift(); // always starts with / - - var end = pieces[pieces.length - 1]; - if (end === "index.html" || end === "") - pieces.pop(); - return(pieces); - } - - function prefix_length(needle, haystack) { - if (needle.length > haystack.length) - return(0); - - // Special case for length-0 haystack, since for loop won't run - if (haystack.length === 0) { - return(needle.length === 0 ? 1 : 0); - } - - for (var i = 0; i < haystack.length; i++) { - if (needle[i] != haystack[i]) - return(i); - } - - return(haystack.length); - } - - /* Clipboard --------------------------*/ - - function changeTooltipMessage(element, msg) { - var tooltipOriginalTitle=element.getAttribute('data-original-title'); - element.setAttribute('data-original-title', msg); - $(element).tooltip('show'); - element.setAttribute('data-original-title', tooltipOriginalTitle); - } - - if(ClipboardJS.isSupported()) { - $(document).ready(function() { - var copyButton = ""; - - $(".examples, div.sourceCode").addClass("hasCopyButton"); - - // Insert copy buttons: - $(copyButton).prependTo(".hasCopyButton"); - - // Initialize tooltips: - $('.btn-copy-ex').tooltip({container: 'body'}); - - // Initialize clipboard: - var clipboardBtnCopies = new ClipboardJS('[data-clipboard-copy]', { - text: function(trigger) { - return trigger.parentNode.textContent; - } - }); - - clipboardBtnCopies.on('success', function(e) { - changeTooltipMessage(e.trigger, 'Copied!'); - e.clearSelection(); - }); - - clipboardBtnCopies.on('error', function() { - changeTooltipMessage(e.trigger,'Press Ctrl+C or Command+C to copy'); - }); - }); - } -})(window.jQuery || window.$) diff --git a/docs/pkgdown.yml b/docs/pkgdown.yml deleted file mode 100644 index 98549d1..0000000 --- a/docs/pkgdown.yml +++ /dev/null @@ -1,6 +0,0 @@ -pandoc: 1.19.2.1 -pkgdown: 1.2.0.9000 -pkgdown_sha: 90eeacd496c5b6ed783c01cb2edeb62ceda6ce05 -articles: - phylotaR: phylotaR.html - diff --git a/docs/pull_request_template.html b/docs/pull_request_template.html deleted file mode 100644 index eb5c248..0000000 --- a/docs/pull_request_template.html +++ /dev/null @@ -1,156 +0,0 @@ - - - - - - - - -NA • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    NA

    -
    - - -
    -

    -Description

    - -
    - -
    -

    -Example

    - - -
    - - -
    - -
    - - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown.

    -
    - -
    -
    - - - - - - diff --git a/docs/reference/ClstrArc-class.html b/docs/reference/ClstrArc-class.html deleted file mode 100644 index d7c88dc..0000000 --- a/docs/reference/ClstrArc-class.html +++ /dev/null @@ -1,1608 +0,0 @@ - - - - - - - - -Cluster record archive — ClstrArc-class • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Cluster record archive

    - Source: R/all-classes.R - -
    - -
    - -

    Multiple cluster records.

    - -
    - - 
    # S4 method for ClstrArc
-as.character(x)
-
-# S4 method for ClstrArc
-show(object)
-
-# S4 method for ClstrArc
-print(x)
-
-# S4 method for ClstrArc
-str(object, max.level = 2L, ...)
-
-# S4 method for ClstrArc
-summary(object)
-
-# S4 method for ClstrArc,character
-[[(x, i)
-
-# S4 method for ClstrArc,character,missing,missing
-[(x, i, j, ...,
-  drop = TRUE)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    x

    ClstrArc object

    object

    ClstrArc object

    max.level

    Maximum level of nesting for str()

    ...

    Further arguments for str()

    i

    cid(s)

    j

    Unused

    drop

    Unused

    - -

    Slots

    - - -
    -
    ids

    Vector of cluster record IDs

    -
    clstrs

    List of ClstrArc named by ID

    -
    - -

    See also

    - -

    Other run-public: ClstrRec-class, - Phylota-class, SeqArc-class, - SeqRec-class, TaxDict-class, - TaxRec-class, clusters2_run, - clusters_run, - parameters_reset, reset, - restart, run, - setup, taxise_run

    - - -

    Examples

    - 
    data('aotus')
-clstrarc <- aotus@clstrs
-# this is a ClstrArc object
-# it contains cluster records
-show(clstrarc)
    #> Archive of cluster record(s)
-#>  - [193] clusters
    # you can access its different data slots with @
-clstrarc@ids     # unique cluster ID
    #>   [1] "0"   "1"   "2"   "3"   "4"   "5"   "6"   "7"   "8"   "9"   "10"  "11" 
-#>  [13] "12"  "13"  "14"  "15"  "16"  "17"  "18"  "19"  "20"  "21"  "22"  "23" 
-#>  [25] "24"  "25"  "26"  "27"  "28"  "29"  "30"  "31"  "32"  "33"  "34"  "35" 
-#>  [37] "36"  "37"  "38"  "39"  "40"  "41"  "42"  "43"  "44"  "45"  "46"  "47" 
-#>  [49] "48"  "49"  "50"  "51"  "52"  "53"  "54"  "55"  "56"  "57"  "58"  "59" 
-#>  [61] "60"  "61"  "62"  "63"  "64"  "65"  "66"  "67"  "68"  "69"  "70"  "71" 
-#>  [73] "72"  "73"  "74"  "75"  "76"  "77"  "78"  "79"  "80"  "81"  "82"  "83" 
-#>  [85] "84"  "85"  "86"  "87"  "88"  "89"  "90"  "91"  "92"  "93"  "94"  "95" 
-#>  [97] "96"  "97"  "98"  "99"  "100" "101" "102" "103" "104" "105" "106" "107"
-#> [109] "108" "109" "110" "111" "112" "113" "114" "115" "116" "117" "118" "119"
-#> [121] "120" "121" "122" "123" "124" "125" "126" "127" "128" "129" "130" "131"
-#> [133] "132" "133" "134" "135" "136" "137" "138" "139" "140" "141" "142" "143"
-#> [145] "144" "145" "146" "147" "148" "149" "150" "151" "152" "153" "154" "155"
-#> [157] "156" "157" "158" "159" "160" "161" "162" "163" "164" "165" "166" "167"
-#> [169] "168" "169" "170" "171" "172" "173" "174" "175" "176" "177" "178" "179"
-#> [181] "180" "181" "182" "183" "184" "185" "186" "187" "188" "189" "190" "191"
-#> [193] "192"
    clstrarc@clstrs  # list of cluster records
    #> $`0`
-#> Cluster Record [id 0]
-#>  - [subtree] type
-#>  - [AF129794.1] seed sequence
-#>  - [204] sequences
-#>  - [5] taxa
-#> 
-#> $`1`
-#> Cluster Record [id 1]
-#>  - [subtree] type
-#>  - [U52114.1] seed sequence
-#>  - [63] sequences
-#>  - [5] taxa
-#> 
-#> $`2`
-#> Cluster Record [id 2]
-#>  - [subtree] type
-#>  - [DI178118.1] seed sequence
-#>  - [52] sequences
-#>  - [2] taxa
-#> 
-#> $`3`
-#> Cluster Record [id 3]
-#>  - [subtree] type
-#>  - [JQ932794.1] seed sequence
-#>  - [43] sequences
-#>  - [4] taxa
-#> 
-#> $`4`
-#> Cluster Record [id 4]
-#>  - [subtree] type
-#>  - [U36844.1] seed sequence
-#>  - [41] sequences
-#>  - [9] taxa
-#> 
-#> $`5`
-#> Cluster Record [id 5]
-#>  - [subtree] type
-#>  - [KF014117.1/1..1263] seed sequence
-#>  - [35] sequences
-#>  - [1] taxa
-#> 
-#> $`6`
-#> Cluster Record [id 6]
-#>  - [subtree] type
-#>  - [LC075891.1] seed sequence
-#>  - [33] sequences
-#>  - [2] taxa
-#> 
-#> $`7`
-#> Cluster Record [id 7]
-#>  - [subtree] type
-#>  - [JN161069.1] seed sequence
-#>  - [30] sequences
-#>  - [1] taxa
-#> 
-#> $`8`
-#> Cluster Record [id 8]
-#>  - [subtree] type
-#>  - [JN161069.1] seed sequence
-#>  - [30] sequences
-#>  - [1] taxa
-#> 
-#> $`9`
-#> Cluster Record [id 9]
-#>  - [subtree] type
-#>  - [AJ489745.1] seed sequence
-#>  - [29] sequences
-#>  - [10] taxa
-#> 
-#> $`10`
-#> Cluster Record [id 10]
-#>  - [subtree] type
-#>  - [AF333711.1] seed sequence
-#>  - [28] sequences
-#>  - [1] taxa
-#> 
-#> $`11`
-#> Cluster Record [id 11]
-#>  - [direct] type
-#>  - [LC075891.1] seed sequence
-#>  - [26] sequences
-#>  - [1] taxa
-#> 
-#> $`12`
-#> Cluster Record [id 12]
-#>  - [subtree] type
-#>  - [JQ932884.1] seed sequence
-#>  - [24] sequences
-#>  - [4] taxa
-#> 
-#> $`13`
-#> Cluster Record [id 13]
-#>  - [subtree] type
-#>  - [AF378747.1] seed sequence
-#>  - [20] sequences
-#>  - [1] taxa
-#> 
-#> $`14`
-#> Cluster Record [id 14]
-#>  - [subtree] type
-#>  - [JQ932881.1] seed sequence
-#>  - [19] sequences
-#>  - [4] taxa
-#> 
-#> $`15`
-#> Cluster Record [id 15]
-#>  - [subtree] type
-#>  - [AY900546.1] seed sequence
-#>  - [19] sequences
-#>  - [1] taxa
-#> 
-#> $`16`
-#> Cluster Record [id 16]
-#>  - [subtree] type
-#>  - [JQ932999.1] seed sequence
-#>  - [18] sequences
-#>  - [1] taxa
-#> 
-#> $`17`
-#> Cluster Record [id 17]
-#>  - [subtree] type
-#>  - [AF027542.1] seed sequence
-#>  - [18] sequences
-#>  - [1] taxa
-#> 
-#> $`18`
-#> Cluster Record [id 18]
-#>  - [subtree] type
-#>  - [AF333712.1] seed sequence
-#>  - [18] sequences
-#>  - [1] taxa
-#> 
-#> $`19`
-#> Cluster Record [id 19]
-#>  - [subtree] type
-#>  - [JQ932845.1] seed sequence
-#>  - [17] sequences
-#>  - [4] taxa
-#> 
-#> $`20`
-#> Cluster Record [id 20]
-#>  - [subtree] type
-#>  - [JQ933027.1] seed sequence
-#>  - [16] sequences
-#>  - [2] taxa
-#> 
-#> $`21`
-#> Cluster Record [id 21]
-#>  - [subtree] type
-#>  - [JQ932800.1] seed sequence
-#>  - [14] sequences
-#>  - [4] taxa
-#> 
-#> $`22`
-#> Cluster Record [id 22]
-#>  - [subtree] type
-#>  - [DQ321662.1] seed sequence
-#>  - [13] sequences
-#>  - [2] taxa
-#> 
-#> $`23`
-#> Cluster Record [id 23]
-#>  - [subtree] type
-#>  - [JQ932874.1] seed sequence
-#>  - [12] sequences
-#>  - [1] taxa
-#> 
-#> $`24`
-#> Cluster Record [id 24]
-#>  - [subtree] type
-#>  - [KY508404.1] seed sequence
-#>  - [12] sequences
-#>  - [1] taxa
-#> 
-#> $`25`
-#> Cluster Record [id 25]
-#>  - [subtree] type
-#>  - [JQ932840.1] seed sequence
-#>  - [11] sequences
-#>  - [1] taxa
-#> 
-#> $`26`
-#> Cluster Record [id 26]
-#>  - [subtree] type
-#>  - [AF107750.1] seed sequence
-#>  - [11] sequences
-#>  - [1] taxa
-#> 
-#> $`27`
-#> Cluster Record [id 27]
-#>  - [direct] type
-#>  - [AB761995.1] seed sequence
-#>  - [11] sequences
-#>  - [1] taxa
-#> 
-#> $`28`
-#> Cluster Record [id 28]
-#>  - [subtree] type
-#>  - [JQ932868.1] seed sequence
-#>  - [10] sequences
-#>  - [2] taxa
-#> 
-#> $`29`
-#> Cluster Record [id 29]
-#>  - [subtree] type
-#>  - [AF338374.1/177..829] seed sequence
-#>  - [10] sequences
-#>  - [8] taxa
-#> 
-#> $`30`
-#> Cluster Record [id 30]
-#>  - [subtree] type
-#>  - [LC075890.1] seed sequence
-#>  - [10] sequences
-#>  - [2] taxa
-#> 
-#> $`31`
-#> Cluster Record [id 31]
-#>  - [subtree] type
-#>  - [AY972694.1] seed sequence
-#>  - [10] sequences
-#>  - [4] taxa
-#> 
-#> $`32`
-#> Cluster Record [id 32]
-#>  - [subtree] type
-#>  - [AY894647.1] seed sequence
-#>  - [10] sequences
-#>  - [1] taxa
-#> 
-#> $`33`
-#> Cluster Record [id 33]
-#>  - [subtree] type
-#>  - [JQ932807.1] seed sequence
-#>  - [9] sequences
-#>  - [1] taxa
-#> 
-#> $`34`
-#> Cluster Record [id 34]
-#>  - [subtree] type
-#>  - [AF042144.1/11..370] seed sequence
-#>  - [8] sequences
-#>  - [3] taxa
-#> 
-#> $`35`
-#> Cluster Record [id 35]
-#>  - [subtree] type
-#>  - [AY900559.1] seed sequence
-#>  - [8] sequences
-#>  - [1] taxa
-#> 
-#> $`36`
-#> Cluster Record [id 36]
-#>  - [subtree] type
-#>  - [HM758648.1] seed sequence
-#>  - [8] sequences
-#>  - [6] taxa
-#> 
-#> $`37`
-#> Cluster Record [id 37]
-#>  - [subtree] type
-#>  - [JQ932913.1] seed sequence
-#>  - [7] sequences
-#>  - [1] taxa
-#> 
-#> $`38`
-#> Cluster Record [id 38]
-#>  - [subtree] type
-#>  - [AY449013.1] seed sequence
-#>  - [7] sequences
-#>  - [1] taxa
-#> 
-#> $`39`
-#> Cluster Record [id 39]
-#>  - [subtree] type
-#>  - [AY900538.1] seed sequence
-#>  - [7] sequences
-#>  - [1] taxa
-#> 
-#> $`40`
-#> Cluster Record [id 40]
-#>  - [subtree] type
-#>  - [HM759273.1] seed sequence
-#>  - [7] sequences
-#>  - [6] taxa
-#> 
-#> $`41`
-#> Cluster Record [id 41]
-#>  - [direct] type
-#>  - [AY449013.1] seed sequence
-#>  - [7] sequences
-#>  - [1] taxa
-#> 
-#> $`42`
-#> Cluster Record [id 42]
-#>  - [direct] type
-#>  - [EF658652.1] seed sequence
-#>  - [7] sequences
-#>  - [1] taxa
-#> 
-#> $`43`
-#> Cluster Record [id 43]
-#>  - [subtree] type
-#>  - [DQ098867.1] seed sequence
-#>  - [7] sequences
-#>  - [2] taxa
-#> 
-#> $`44`
-#> Cluster Record [id 44]
-#>  - [subtree] type
-#>  - [NM_001308532.1/14..457] seed sequence
-#>  - [6] sequences
-#>  - [4] taxa
-#> 
-#> $`45`
-#> Cluster Record [id 45]
-#>  - [subtree] type
-#>  - [AY646198.1/152..1576] seed sequence
-#>  - [6] sequences
-#>  - [1] taxa
-#> 
-#> $`46`
-#> Cluster Record [id 46]
-#>  - [subtree] type
-#>  - [AF201293.1/23..790] seed sequence
-#>  - [6] sequences
-#>  - [1] taxa
-#> 
-#> $`47`
-#> Cluster Record [id 47]
-#>  - [subtree] type
-#>  - [GQ279878.1] seed sequence
-#>  - [6] sequences
-#>  - [4] taxa
-#> 
-#> $`48`
-#> Cluster Record [id 48]
-#>  - [subtree] type
-#>  - [KC761051.1] seed sequence
-#>  - [6] sequences
-#>  - [4] taxa
-#> 
-#> $`49`
-#> Cluster Record [id 49]
-#>  - [subtree] type
-#>  - [GQ279822.1] seed sequence
-#>  - [6] sequences
-#>  - [4] taxa
-#> 
-#> $`50`
-#> Cluster Record [id 50]
-#>  - [subtree] type
-#>  - [HM756838.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`51`
-#> Cluster Record [id 51]
-#>  - [subtree] type
-#>  - [HM757379.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`52`
-#> Cluster Record [id 52]
-#>  - [subtree] type
-#>  - [HM757554.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`53`
-#> Cluster Record [id 53]
-#>  - [subtree] type
-#>  - [HM757720.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`54`
-#> Cluster Record [id 54]
-#>  - [subtree] type
-#>  - [HM758212.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`55`
-#> Cluster Record [id 55]
-#>  - [subtree] type
-#>  - [HM758295.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`56`
-#> Cluster Record [id 56]
-#>  - [subtree] type
-#>  - [HM758463.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`57`
-#> Cluster Record [id 57]
-#>  - [subtree] type
-#>  - [HM758930.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`58`
-#> Cluster Record [id 58]
-#>  - [subtree] type
-#>  - [HM759101.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`59`
-#> Cluster Record [id 59]
-#>  - [subtree] type
-#>  - [HM759370.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`60`
-#> Cluster Record [id 60]
-#>  - [subtree] type
-#>  - [HM759641.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`61`
-#> Cluster Record [id 61]
-#>  - [subtree] type
-#>  - [HM759729.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`62`
-#> Cluster Record [id 62]
-#>  - [subtree] type
-#>  - [HM759894.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`63`
-#> Cluster Record [id 63]
-#>  - [subtree] type
-#>  - [HM760078.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`64`
-#> Cluster Record [id 64]
-#>  - [subtree] type
-#>  - [HM760254.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`65`
-#> Cluster Record [id 65]
-#>  - [subtree] type
-#>  - [HM760525.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`66`
-#> Cluster Record [id 66]
-#>  - [subtree] type
-#>  - [HM760606.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`67`
-#> Cluster Record [id 67]
-#>  - [subtree] type
-#>  - [HM761193.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`68`
-#> Cluster Record [id 68]
-#>  - [subtree] type
-#>  - [HM761505.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`69`
-#> Cluster Record [id 69]
-#>  - [subtree] type
-#>  - [HM761768.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`70`
-#> Cluster Record [id 70]
-#>  - [subtree] type
-#>  - [HM761925.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`71`
-#> Cluster Record [id 71]
-#>  - [subtree] type
-#>  - [HM762092.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`72`
-#> Cluster Record [id 72]
-#>  - [subtree] type
-#>  - [HM762180.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`73`
-#> Cluster Record [id 73]
-#>  - [subtree] type
-#>  - [HM762427.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`74`
-#> Cluster Record [id 74]
-#>  - [subtree] type
-#>  - [HM762765.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`75`
-#> Cluster Record [id 75]
-#>  - [subtree] type
-#>  - [HM763261.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`76`
-#> Cluster Record [id 76]
-#>  - [subtree] type
-#>  - [HM763429.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`77`
-#> Cluster Record [id 77]
-#>  - [subtree] type
-#>  - [HM763727.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`78`
-#> Cluster Record [id 78]
-#>  - [subtree] type
-#>  - [HM764102.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`79`
-#> Cluster Record [id 79]
-#>  - [subtree] type
-#>  - [HM764317.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`80`
-#> Cluster Record [id 80]
-#>  - [subtree] type
-#>  - [HM764901.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`81`
-#> Cluster Record [id 81]
-#>  - [subtree] type
-#>  - [HM765175.1] seed sequence
-#>  - [6] sequences
-#>  - [6] taxa
-#> 
-#> $`82`
-#> Cluster Record [id 82]
-#>  - [subtree] type
-#>  - [GQ279948.1] seed sequence
-#>  - [5] sequences
-#>  - [3] taxa
-#> 
-#> $`83`
-#> Cluster Record [id 83]
-#>  - [subtree] type
-#>  - [HM762509.1] seed sequence
-#>  - [5] sequences
-#>  - [5] taxa
-#> 
-#> $`84`
-#> Cluster Record [id 84]
-#>  - [subtree] type
-#>  - [HM764645.1] seed sequence
-#>  - [5] sequences
-#>  - [5] taxa
-#> 
-#> $`85`
-#> Cluster Record [id 85]
-#>  - [subtree] type
-#>  - [HM764813.1] seed sequence
-#>  - [5] sequences
-#>  - [5] taxa
-#> 
-#> $`86`
-#> Cluster Record [id 86]
-#>  - [subtree] type
-#>  - [FJ638414.1] seed sequence
-#>  - [5] sequences
-#>  - [3] taxa
-#> 
-#> $`87`
-#> Cluster Record [id 87]
-#>  - [subtree] type
-#>  - [JQ933005.1] seed sequence
-#>  - [5] sequences
-#>  - [1] taxa
-#> 
-#> $`88`
-#> Cluster Record [id 88]
-#>  - [subtree] type
-#>  - [JQ932259.1] seed sequence
-#>  - [5] sequences
-#>  - [1] taxa
-#> 
-#> $`89`
-#> Cluster Record [id 89]
-#>  - [subtree] type
-#>  - [JQ932280.1] seed sequence
-#>  - [5] sequences
-#>  - [4] taxa
-#> 
-#> $`90`
-#> Cluster Record [id 90]
-#>  - [subtree] type
-#>  - [JQ932662.1] seed sequence
-#>  - [5] sequences
-#>  - [4] taxa
-#> 
-#> $`91`
-#> Cluster Record [id 91]
-#>  - [subtree] type
-#>  - [JQ932630.1] seed sequence
-#>  - [5] sequences
-#>  - [1] taxa
-#> 
-#> $`92`
-#> Cluster Record [id 92]
-#>  - [subtree] type
-#>  - [JQ932880.1] seed sequence
-#>  - [5] sequences
-#>  - [1] taxa
-#> 
-#> $`93`
-#> Cluster Record [id 93]
-#>  - [subtree] type
-#>  - [DQ989366.1] seed sequence
-#>  - [5] sequences
-#>  - [5] taxa
-#> 
-#> $`94`
-#> Cluster Record [id 94]
-#>  - [subtree] type
-#>  - [FJ623078.1] seed sequence
-#>  - [4] sequences
-#>  - [3] taxa
-#> 
-#> $`95`
-#> Cluster Record [id 95]
-#>  - [subtree] type
-#>  - [DQ334827.1] seed sequence
-#>  - [4] sequences
-#>  - [2] taxa
-#> 
-#> $`96`
-#> Cluster Record [id 96]
-#>  - [subtree] type
-#>  - [AF042144.1/371..877] seed sequence
-#>  - [4] sequences
-#>  - [2] taxa
-#> 
-#> $`97`
-#> Cluster Record [id 97]
-#>  - [subtree] type
-#>  - [AB181217.1/1545..1839] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`98`
-#> Cluster Record [id 98]
-#>  - [subtree] type
-#>  - [AF397604.1/737..1037] seed sequence
-#>  - [4] sequences
-#>  - [2] taxa
-#> 
-#> $`99`
-#> Cluster Record [id 99]
-#>  - [subtree] type
-#>  - [AY449010.1] seed sequence
-#>  - [4] sequences
-#>  - [1] taxa
-#> 
-#> $`100`
-#> Cluster Record [id 100]
-#>  - [subtree] type
-#>  - [AY900524.1] seed sequence
-#>  - [4] sequences
-#>  - [1] taxa
-#> 
-#> $`101`
-#> Cluster Record [id 101]
-#>  - [subtree] type
-#>  - [AF489244.1/762..1058] seed sequence
-#>  - [4] sequences
-#>  - [2] taxa
-#> 
-#> $`102`
-#> Cluster Record [id 102]
-#>  - [subtree] type
-#>  - [AB081280.2] seed sequence
-#>  - [4] sequences
-#>  - [1] taxa
-#> 
-#> $`103`
-#> Cluster Record [id 103]
-#>  - [subtree] type
-#>  - [AB081278.2] seed sequence
-#>  - [4] sequences
-#>  - [1] taxa
-#> 
-#> $`104`
-#> Cluster Record [id 104]
-#>  - [subtree] type
-#>  - [AB181209.1] seed sequence
-#>  - [4] sequences
-#>  - [1] taxa
-#> 
-#> $`105`
-#> Cluster Record [id 105]
-#>  - [subtree] type
-#>  - [HM761011.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`106`
-#> Cluster Record [id 106]
-#>  - [subtree] type
-#>  - [HM761143.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`107`
-#> Cluster Record [id 107]
-#>  - [subtree] type
-#>  - [HM762856.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`108`
-#> Cluster Record [id 108]
-#>  - [subtree] type
-#>  - [HM763019.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`109`
-#> Cluster Record [id 109]
-#>  - [subtree] type
-#>  - [HM763994.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`110`
-#> Cluster Record [id 110]
-#>  - [subtree] type
-#>  - [HM764394.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`111`
-#> Cluster Record [id 111]
-#>  - [subtree] type
-#>  - [KC760417.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`112`
-#> Cluster Record [id 112]
-#>  - [subtree] type
-#>  - [KC760385.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`113`
-#> Cluster Record [id 113]
-#>  - [subtree] type
-#>  - [KC760326.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`114`
-#> Cluster Record [id 114]
-#>  - [subtree] type
-#>  - [KC760263.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`115`
-#> Cluster Record [id 115]
-#>  - [subtree] type
-#>  - [KC760228.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`116`
-#> Cluster Record [id 116]
-#>  - [subtree] type
-#>  - [AB239200.1] seed sequence
-#>  - [4] sequences
-#>  - [1] taxa
-#> 
-#> $`117`
-#> Cluster Record [id 117]
-#>  - [subtree] type
-#>  - [AF027546.1/1..274] seed sequence
-#>  - [4] sequences
-#>  - [1] taxa
-#> 
-#> $`118`
-#> Cluster Record [id 118]
-#>  - [subtree] type
-#>  - [KC762160.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`119`
-#> Cluster Record [id 119]
-#>  - [subtree] type
-#>  - [KC762072.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`120`
-#> Cluster Record [id 120]
-#>  - [subtree] type
-#>  - [KC762014.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`121`
-#> Cluster Record [id 121]
-#>  - [subtree] type
-#>  - [KC761980.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`122`
-#> Cluster Record [id 122]
-#>  - [subtree] type
-#>  - [KC761951.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`123`
-#> Cluster Record [id 123]
-#>  - [subtree] type
-#>  - [KC761918.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`124`
-#> Cluster Record [id 124]
-#>  - [subtree] type
-#>  - [KC761889.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`125`
-#> Cluster Record [id 125]
-#>  - [subtree] type
-#>  - [KC761833.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`126`
-#> Cluster Record [id 126]
-#>  - [subtree] type
-#>  - [KC761782.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`127`
-#> Cluster Record [id 127]
-#>  - [subtree] type
-#>  - [KC761695.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`128`
-#> Cluster Record [id 128]
-#>  - [subtree] type
-#>  - [KC761632.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`129`
-#> Cluster Record [id 129]
-#>  - [subtree] type
-#>  - [KC761601.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`130`
-#> Cluster Record [id 130]
-#>  - [subtree] type
-#>  - [KC761569.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`131`
-#> Cluster Record [id 131]
-#>  - [subtree] type
-#>  - [KC761504.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`132`
-#> Cluster Record [id 132]
-#>  - [subtree] type
-#>  - [KC761470.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`133`
-#> Cluster Record [id 133]
-#>  - [subtree] type
-#>  - [KC761405.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`134`
-#> Cluster Record [id 134]
-#>  - [subtree] type
-#>  - [KC761242.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`135`
-#> Cluster Record [id 135]
-#>  - [subtree] type
-#>  - [KC761177.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`136`
-#> Cluster Record [id 136]
-#>  - [subtree] type
-#>  - [KC761016.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`137`
-#> Cluster Record [id 137]
-#>  - [subtree] type
-#>  - [KC760988.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`138`
-#> Cluster Record [id 138]
-#>  - [subtree] type
-#>  - [KC760954.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`139`
-#> Cluster Record [id 139]
-#>  - [subtree] type
-#>  - [KC760866.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`140`
-#> Cluster Record [id 140]
-#>  - [subtree] type
-#>  - [KC760833.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`141`
-#> Cluster Record [id 141]
-#>  - [subtree] type
-#>  - [KC760802.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`142`
-#> Cluster Record [id 142]
-#>  - [subtree] type
-#>  - [KC760738.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`143`
-#> Cluster Record [id 143]
-#>  - [subtree] type
-#>  - [KC760712.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`144`
-#> Cluster Record [id 144]
-#>  - [subtree] type
-#>  - [KC760681.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`145`
-#> Cluster Record [id 145]
-#>  - [subtree] type
-#>  - [KC760611.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`146`
-#> Cluster Record [id 146]
-#>  - [subtree] type
-#>  - [KC760514.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`147`
-#> Cluster Record [id 147]
-#>  - [subtree] type
-#>  - [AF014508.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`148`
-#> Cluster Record [id 148]
-#>  - [subtree] type
-#>  - [AF014506.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`149`
-#> Cluster Record [id 149]
-#>  - [subtree] type
-#>  - [AF014509.1] seed sequence
-#>  - [4] sequences
-#>  - [4] taxa
-#> 
-#> $`150`
-#> Cluster Record [id 150]
-#>  - [direct] type
-#>  - [AY449010.1] seed sequence
-#>  - [4] sequences
-#>  - [1] taxa
-#> 
-#> $`151`
-#> Cluster Record [id 151]
-#>  - [direct] type
-#>  - [DQ098863.1] seed sequence
-#>  - [4] sequences
-#>  - [1] taxa
-#> 
-#> $`152`
-#> Cluster Record [id 152]
-#>  - [direct] type
-#>  - [DQ098851.1/1..495] seed sequence
-#>  - [4] sequences
-#>  - [1] taxa
-#> 
-#> $`153`
-#> Cluster Record [id 153]
-#>  - [direct] type
-#>  - [LC075890.1] seed sequence
-#>  - [4] sequences
-#>  - [1] taxa
-#> 
-#> $`154`
-#> Cluster Record [id 154]
-#>  - [subtree] type
-#>  - [AB081280.2] seed sequence
-#>  - [4] sequences
-#>  - [1] taxa
-#> 
-#> $`155`
-#> Cluster Record [id 155]
-#>  - [subtree] type
-#>  - [AB081279.2] seed sequence
-#>  - [4] sequences
-#>  - [1] taxa
-#> 
-#> $`156`
-#> Cluster Record [id 156]
-#>  - [subtree] type
-#>  - [AB081278.2] seed sequence
-#>  - [4] sequences
-#>  - [1] taxa
-#> 
-#> $`157`
-#> Cluster Record [id 157]
-#>  - [subtree] type
-#>  - [AB181209.1] seed sequence
-#>  - [4] sequences
-#>  - [1] taxa
-#> 
-#> $`158`
-#> Cluster Record [id 158]
-#>  - [subtree] type
-#>  - [HM758657.1] seed sequence
-#>  - [4] sequences
-#>  - [2] taxa
-#> 
-#> $`159`
-#> Cluster Record [id 159]
-#>  - [subtree] type
-#>  - [AY449065.1] seed sequence
-#>  - [3] sequences
-#>  - [1] taxa
-#> 
-#> $`160`
-#> Cluster Record [id 160]
-#>  - [subtree] type
-#>  - [AY449057.1] seed sequence
-#>  - [3] sequences
-#>  - [1] taxa
-#> 
-#> $`161`
-#> Cluster Record [id 161]
-#>  - [subtree] type
-#>  - [AY455162.1] seed sequence
-#>  - [3] sequences
-#>  - [1] taxa
-#> 
-#> $`162`
-#> Cluster Record [id 162]
-#>  - [subtree] type
-#>  - [AB181208.1/452..749] seed sequence
-#>  - [3] sequences
-#>  - [1] taxa
-#> 
-#> $`163`
-#> Cluster Record [id 163]
-#>  - [subtree] type
-#>  - [AB181207.1] seed sequence
-#>  - [3] sequences
-#>  - [1] taxa
-#> 
-#> $`164`
-#> Cluster Record [id 164]
-#>  - [subtree] type
-#>  - [AB023937.1] seed sequence
-#>  - [3] sequences
-#>  - [1] taxa
-#> 
-#> $`165`
-#> Cluster Record [id 165]
-#>  - [subtree] type
-#>  - [HM756999.1] seed sequence
-#>  - [3] sequences
-#>  - [3] taxa
-#> 
-#> $`166`
-#> Cluster Record [id 166]
-#>  - [subtree] type
-#>  - [HM760774.1] seed sequence
-#>  - [3] sequences
-#>  - [3] taxa
-#> 
-#> $`167`
-#> Cluster Record [id 167]
-#>  - [subtree] type
-#>  - [HM763503.1] seed sequence
-#>  - [3] sequences
-#>  - [3] taxa
-#> 
-#> $`168`
-#> Cluster Record [id 168]
-#>  - [subtree] type
-#>  - [HM763844.1] seed sequence
-#>  - [3] sequences
-#>  - [3] taxa
-#> 
-#> $`169`
-#> Cluster Record [id 169]
-#>  - [subtree] type
-#>  - [AB181217.1/324..590] seed sequence
-#>  - [3] sequences
-#>  - [2] taxa
-#> 
-#> $`170`
-#> Cluster Record [id 170]
-#>  - [subtree] type
-#>  - [KC760295.1] seed sequence
-#>  - [3] sequences
-#>  - [3] taxa
-#> 
-#> $`171`
-#> Cluster Record [id 171]
-#>  - [subtree] type
-#>  - [AB239246.1] seed sequence
-#>  - [3] sequences
-#>  - [1] taxa
-#> 
-#> $`172`
-#> Cluster Record [id 172]
-#>  - [subtree] type
-#>  - [AB239226.1] seed sequence
-#>  - [3] sequences
-#>  - [1] taxa
-#> 
-#> $`173`
-#> Cluster Record [id 173]
-#>  - [subtree] type
-#>  - [AF486448.1] seed sequence
-#>  - [3] sequences
-#>  - [1] taxa
-#> 
-#> $`174`
-#> Cluster Record [id 174]
-#>  - [subtree] type
-#>  - [KM206804.1] seed sequence
-#>  - [3] sequences
-#>  - [3] taxa
-#> 
-#> $`175`
-#> Cluster Record [id 175]
-#>  - [subtree] type
-#>  - [KC762127.1] seed sequence
-#>  - [3] sequences
-#>  - [3] taxa
-#> 
-#> $`176`
-#> Cluster Record [id 176]
-#>  - [subtree] type
-#>  - [KC762104.1] seed sequence
-#>  - [3] sequences
-#>  - [3] taxa
-#> 
-#> $`177`
-#> Cluster Record [id 177]
-#>  - [subtree] type
-#>  - [KC761755.1] seed sequence
-#>  - [3] sequences
-#>  - [3] taxa
-#> 
-#> $`178`
-#> Cluster Record [id 178]
-#>  - [subtree] type
-#>  - [KC761438.1] seed sequence
-#>  - [3] sequences
-#>  - [3] taxa
-#> 
-#> $`179`
-#> Cluster Record [id 179]
-#>  - [subtree] type
-#>  - [KC761371.1] seed sequence
-#>  - [3] sequences
-#>  - [3] taxa
-#> 
-#> $`180`
-#> Cluster Record [id 180]
-#>  - [subtree] type
-#>  - [KC761338.1] seed sequence
-#>  - [3] sequences
-#>  - [3] taxa
-#> 
-#> $`181`
-#> Cluster Record [id 181]
-#>  - [subtree] type
-#>  - [KC761277.1] seed sequence
-#>  - [3] sequences
-#>  - [3] taxa
-#> 
-#> $`182`
-#> Cluster Record [id 182]
-#>  - [subtree] type
-#>  - [KC761210.1] seed sequence
-#>  - [3] sequences
-#>  - [3] taxa
-#> 
-#> $`183`
-#> Cluster Record [id 183]
-#>  - [subtree] type
-#>  - [KC760920.1] seed sequence
-#>  - [3] sequences
-#>  - [3] taxa
-#> 
-#> $`184`
-#> Cluster Record [id 184]
-#>  - [subtree] type
-#>  - [KC760770.1] seed sequence
-#>  - [3] sequences
-#>  - [3] taxa
-#> 
-#> $`185`
-#> Cluster Record [id 185]
-#>  - [subtree] type
-#>  - [KC760546.1] seed sequence
-#>  - [3] sequences
-#>  - [3] taxa
-#> 
-#> $`186`
-#> Cluster Record [id 186]
-#>  - [direct] type
-#>  - [AY449065.1] seed sequence
-#>  - [3] sequences
-#>  - [1] taxa
-#> 
-#> $`187`
-#> Cluster Record [id 187]
-#>  - [direct] type
-#>  - [AY449057.1] seed sequence
-#>  - [3] sequences
-#>  - [1] taxa
-#> 
-#> $`188`
-#> Cluster Record [id 188]
-#>  - [direct] type
-#>  - [AY455162.1] seed sequence
-#>  - [3] sequences
-#>  - [1] taxa
-#> 
-#> $`189`
-#> Cluster Record [id 189]
-#>  - [subtree] type
-#>  - [AB181208.1/452..749] seed sequence
-#>  - [3] sequences
-#>  - [1] taxa
-#> 
-#> $`190`
-#> Cluster Record [id 190]
-#>  - [subtree] type
-#>  - [AB181207.1] seed sequence
-#>  - [3] sequences
-#>  - [1] taxa
-#> 
-#> $`191`
-#> Cluster Record [id 191]
-#>  - [subtree] type
-#>  - [HM759274.1] seed sequence
-#>  - [3] sequences
-#>  - [2] taxa
-#> 
-#> $`192`
-#> Cluster Record [id 192]
-#>  - [subtree] type
-#>  - [AF338376.1/177..829] seed sequence
-#>  - [3] sequences
-#>  - [2] taxa
-#> 
    # access cluster records [[
-(clstrarc[[clstrarc@ids[[1]]]])  # first cluster record
    #> Cluster Record [id 0]
-#>  - [subtree] type
-#>  - [AF129794.1] seed sequence
-#>  - [204] sequences
-#>  - [5] taxa
    # generate new cluster archives with [
-(clstrarc[clstrarc@ids[1:10]])  # first 10 clusters
    #> Archive of cluster record(s)
-#>  - [10] clusters
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/ClstrRec-class.html b/docs/reference/ClstrRec-class.html deleted file mode 100644 index a7f2bf6..0000000 --- a/docs/reference/ClstrRec-class.html +++ /dev/null @@ -1,317 +0,0 @@ - - - - - - - - -Cluster record — ClstrRec-class • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Cluster record

    - Source: R/all-classes.R - -
    - -
    - -

    Cluster record contains all information on a cluster.

    - -
    - - 
    # S4 method for ClstrRec
-as.character(x)
-
-# S4 method for ClstrRec
-show(object)
-
-# S4 method for ClstrRec
-print(x)
-
-# S4 method for ClstrRec
-str(object, max.level = 2L, ...)
-
-# S4 method for ClstrRec
-summary(object)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - -
    x

    ClstrRec object

    object

    ClstrRec object

    max.level

    Maximum level of nesting for str()

    ...

    Further arguments for str()

    - -

    Slots

    - - -
    -
    id

    Cluster ID, integer

    -
    sids

    Sequence IDs

    -
    nsqs

    Number of sequences

    -
    txids

    Source txids for sequences

    -
    ntx

    Number of taxa

    -
    typ

    Cluster type: direct, subtree or merged

    -
    seed

    Seed sequence ID

    -
    prnt

    Parent taxonomic ID

    -
    - -

    See also

    - -

    Other run-public: ClstrArc-class, - Phylota-class, SeqArc-class, - SeqRec-class, TaxDict-class, - TaxRec-class, clusters2_run, - clusters_run, - parameters_reset, reset, - restart, run, - setup, taxise_run

    - - -

    Examples

    - 
    data('aotus')
-clstrrec <- aotus@clstrs@clstrs[[1]]
-# this is a ClstrRec object
-# it contains cluster information
-show(clstrrec)
    #> Cluster Record [id 0]
-#>  - [subtree] type
-#>  - [AF129794.1] seed sequence
-#>  - [204] sequences
-#>  - [5] taxa
    # you can access its different data slots with @
-clstrrec@id     # cluster id
    #> [1] 0
    clstrrec@sids   # sequence IDs
    #>   [1] "AF129792.1"         "AF129793.1"         "AF129794.1"        
-#>   [4] "AF129795.1"         "AF129796.1"         "AF129797.1"        
-#>   [7] "AF129798.1"         "AF129799.1"         "AF129800.1"        
-#>  [10] "AF129801.1"         "AF129802.1"         "AF129803.1"        
-#>  [13] "AF129804.1"         "AF129805.1"         "AF129806.1"        
-#>  [16] "AF129807.1"         "AF129808.1"         "AF132755.1"        
-#>  [19] "AF132756.1"         "AF132757.1"         "AF132758.1"        
-#>  [22] "AF132759.1"         "AF132760.1"         "AF132761.1"        
-#>  [25] "AF132762.1"         "AF132763.1"         "AF132764.1"        
-#>  [28] "AF132765.1"         "AF132766.1"         "AF132767.1"        
-#>  [31] "AF132768.1"         "AF132769.1"         "AF132770.1"        
-#>  [34] "AF169485.1"         "AF169486.1"         "AF169487.1"        
-#>  [37] "AY227055.1"         "AY227056.1"         "AY227057.1"        
-#>  [40] "AY227058.1"         "AY227059.1"         "AY227060.1"        
-#>  [43] "AY227061.1"         "AY227062.1"         "AY227063.1"        
-#>  [46] "AY227064.1"         "AY227065.1"         "AY227066.1"        
-#>  [49] "AY227067.1"         "AY227068.1"         "AY227069.1"        
-#>  [52] "AY227070.1"         "AY227071.1"         "AY227072.1"        
-#>  [55] "AY227073.1"         "AY227074.1"         "AY429142.1"        
-#>  [58] "AY429143.1"         "AY493661.1"         "AY563180.2"        
-#>  [61] "AY563181.2"         "AY563182.2"         "AY563183.2"        
-#>  [64] "AY563184.2"         "AY563185.2"         "AY563186.2"        
-#>  [67] "AY563188.2"         "AY563189.2"         "AY563190.2"        
-#>  [70] "AY563191.2"         "AY563192.2"         "AY563193.2"        
-#>  [73] "AY563194.2"         "AY563195.2"         "AY563196.2"        
-#>  [76] "AY563197.2"         "AY563198.2"         "AY563199.2"        
-#>  [79] "AY563200.2"         "AY563201.2"         "AY563202.2"        
-#>  [82] "AY563203.2"         "AY563204.2"         "AY563206.2"        
-#>  [85] "AY563207.2"         "AY563208.2"         "AY563209.2"        
-#>  [88] "AY563210.2"         "AY563211.2"         "AY563212.2"        
-#>  [91] "AY563213.2"         "AY563214.2"         "AY563215.2"        
-#>  [94] "AY563216.2"         "AY563217.2"         "AY563218.2"        
-#>  [97] "AY563219.2"         "AY563220.2"         "AY563221.2"        
-#> [100] "AY563222.2"         "AY563223.2"         "AY563224.2"        
-#> [103] "AY563225.2"         "AY563226.2"         "AY563227.2"        
-#> [106] "AY563228.2"         "AY563229.2"         "AY563230.2"        
-#> [109] "AY563231.2"         "AY563232.2"         "AY563233.2"        
-#> [112] "AY563234.2"         "AY563236.2"         "AY563237.2"        
-#> [115] "AY563239.2"         "AY563241.2"         "AY563242.2"        
-#> [118] "AY563243.2"         "AY563244.2"         "AY563245.2"        
-#> [121] "AY563246.2"         "AY563247.2"         "AY563248.2"        
-#> [124] "AY563249.2"         "AY563250.2"         "AY563251.2"        
-#> [127] "AY563252.2"         "AY563253.2"         "AY563254.2"        
-#> [130] "AY563255.2"         "AY563256.2"         "AY563257.2"        
-#> [133] "AY563258.2"         "AY563259.2"         "AY563260.2"        
-#> [136] "AY563261.2"         "AY563262.2"         "AY563263.2"        
-#> [139] "DQ162624.1"         "DQ162626.1"         "DQ162627.1"        
-#> [142] "DQ162628.1"         "DQ162629.1"         "DQ162630.1"        
-#> [145] "DQ162633.1"         "DQ162634.1"         "DQ162635.1"        
-#> [148] "DQ162645.1"         "DQ162646.1"         "DQ162647.1"        
-#> [151] "DQ162648.1"         "DQ162660.1"         "DQ162661.1"        
-#> [154] "DQ162668.1"         "DQ162676.1"         "DQ162679.1"        
-#> [157] "DQ162682.1"         "DQ162683.1"         "DQ162688.1"        
-#> [160] "DQ162699.1"         "DQ162704.1"         "DQ162705.1"        
-#> [163] "DQ162710.1"         "DQ162711.1"         "DQ162718.1"        
-#> [166] "DQ162719.1"         "DQ162727.1"         "DQ162729.1"        
-#> [169] "DQ162732.1"         "DQ162736.1"         "KF447733.1/16..285"
-#> [172] "KF447734.1/16..285" "KF447735.1/16..285" "KF447736.1/16..285"
-#> [175] "KF447737.1/16..285" "KF447738.2/16..285" "KF447739.1/16..285"
-#> [178] "KF447740.1/16..285" "KF447741.1/16..285" "KF447742.1/16..285"
-#> [181] "KF447743.1/16..285" "KF447744.1/16..285" "KF447745.1/16..285"
-#> [184] "KF447746.1/16..285" "KF447747.1/16..285" "KF447748.1/16..285"
-#> [187] "KF447749.1/16..285" "KF447750.1/16..285" "KF447751.1/16..285"
-#> [190] "KF447752.1/16..285" "KF447753.1/16..285" "KF447754.1/16..285"
-#> [193] "KF447755.1/16..285" "KF447756.1/16..285" "KF447757.1/16..285"
-#> [196] "KF447758.1/16..285" "KF447759.1/16..285" "KF447760.1/16..285"
-#> [199] "KF447761.1/16..285" "KF447762.1/16..285" "KF447763.1/16..285"
-#> [202] "KF447764.1/16..285" "KF447765.1/16..285" "KF447766.1/16..285"
    clstrrec@nsqs   # number of sequences
    #> [1] 204
    clstrrec@txids  # taxonomic IDs of sequences
    #>   [1] "231953" "231953" "231953" "231953" "231953" "231953" "231953" "231953"
-#>   [9] "231953" "231953" "231953" "231953" "231953" "231953" "231953" "231953"
-#>  [17] "231953" "231953" "231953" "231953" "37293"  "37293"  "37293"  "37293" 
-#>  [25] "30591"  "30591"  "37293"  "37293"  "37293"  "37293"  "37293"  "37293" 
-#>  [33] "37293"  "37293"  "37293"  "37293"  "37293"  "37293"  "37293"  "57175" 
-#>  [41] "37293"  "37293"  "37293"  "37293"  "37293"  "37293"  "37293"  "37293" 
-#>  [49] "37293"  "37293"  "37293"  "37293"  "37293"  "57175"  "37293"  "37293" 
-#>  [57] "37293"  "37293"  "37293"  "57176"  "57176"  "57176"  "57176"  "57176" 
-#>  [65] "57176"  "37293"  "37293"  "57176"  "57176"  "57176"  "57176"  "37293" 
-#>  [73] "37293"  "37293"  "37293"  "37293"  "37293"  "37293"  "37293"  "37293" 
-#>  [81] "37293"  "37293"  "37293"  "37293"  "57176"  "57176"  "57176"  "57176" 
-#>  [89] "57176"  "57176"  "57176"  "37293"  "57176"  "57175"  "57175"  "57175" 
-#>  [97] "57175"  "57175"  "57175"  "57175"  "57175"  "37293"  "37293"  "37293" 
-#> [105] "37293"  "37293"  "37293"  "37293"  "37293"  "37293"  "37293"  "37293" 
-#> [113] "37293"  "37293"  "37293"  "37293"  "57176"  "57176"  "57176"  "57176" 
-#> [121] "57176"  "57176"  "57176"  "57176"  "57176"  "57176"  "57175"  "57175" 
-#> [129] "57175"  "57175"  "57176"  "57175"  "57175"  "37293"  "57175"  "57175" 
-#> [137] "57175"  "57175"  "57175"  "57175"  "57175"  "57175"  "57175"  "57175" 
-#> [145] "57175"  "57175"  "57175"  "57175"  "37293"  "37293"  "37293"  "37293" 
-#> [153] "37293"  "37293"  "37293"  "37293"  "57175"  "37293"  "57176"  "57175" 
-#> [161] "37293"  "37293"  "37293"  "37293"  "37293"  "37293"  "57176"  "37293" 
-#> [169] "37293"  "37293"  "37293"  "37293"  "37293"  "37293"  "37293"  "37293" 
-#> [177] "37293"  "37293"  "37293"  "37293"  "37293"  "37293"  "37293"  "37293" 
-#> [185] "37293"  "37293"  "37293"  "37293"  "37293"  "37293"  "37293"  "37293" 
-#> [193] "37293"  "37293"  "37293"  "37293"  "37293"  "37293"  "37293"  "37293" 
-#> [201] "37293"  "37293"  "37293"  "37293" 
    clstrrec@ntx    # number unique taxonomic IDs
    #> [1] 5
    clstrrec@typ    # cluster type: merged, subtree, direct or paraphyly
    #> [1] "subtree"
    clstrrec@prnt   # MRCA of all taxa
    #> [1] "9504"
    clstrrec@seed   # most inter-connected sequence
    #> [1] "AF129794.1"
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/Phylota-class.html b/docs/reference/Phylota-class.html deleted file mode 100644 index 779f00b..0000000 --- a/docs/reference/Phylota-class.html +++ /dev/null @@ -1,810 +0,0 @@ - - - - - - - - -Phylota object — Phylota-class • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Phylota object

    - Source: R/all-classes.R - -
    - -
    - -

    Phylota table contains all sequence, cluster and taxonomic -information from a phylotaR pipeline run.

    - -
    - - 
    # S4 method for Phylota
-as.character(x)
-
-# S4 method for Phylota
-show(object)
-
-# S4 method for Phylota
-print(x)
-
-# S4 method for Phylota
-str(object, max.level = 2L, ...)
-
-# S4 method for Phylota
-summary(object)
-
-# S4 method for Phylota,character
-[[(x, i)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - -
    x

    Phylota object

    object

    Phylota object

    max.level

    Maximum level of nesting for str()

    ...

    Further arguments for str()

    i

    Either sid or cid

    - -

    Slots

    - - -
    -
    cids

    IDs of all clusters

    -
    sids

    IDs of all sequences

    -
    txids

    IDs of all taxa

    -
    sqs

    All sequence records as SeqArc

    -
    clstrs

    All cluster records as ClstrArc

    -
    txdct

    Taxonomic dictionary as TaxDict

    -
    prnt_id

    Parent taxonomic ID

    -
    prnt_nm

    Parent taxonomic name

    -
    - -

    See also

    - -

    Other run-public: ClstrArc-class, - ClstrRec-class, SeqArc-class, - SeqRec-class, TaxDict-class, - TaxRec-class, clusters2_run, - clusters_run, - parameters_reset, reset, - restart, run, - setup, taxise_run

    - - -

    Examples

    - 
    data('aotus')
-# this is a Phylota object
-# it contains cluster, sequence and taxonomic information from a phylotaR run
-show(aotus)
    #> Phylota Table (Aotus)
-#> - [193] clusters
-#> - [1499] sequences
-#> - [13] source taxa
    # you can access its different data slots with @
-aotus@cids   # cluster IDs
    #>   [1] "0"   "1"   "2"   "3"   "4"   "5"   "6"   "7"   "8"   "9"   "10"  "11" 
-#>  [13] "12"  "13"  "14"  "15"  "16"  "17"  "18"  "19"  "20"  "21"  "22"  "23" 
-#>  [25] "24"  "25"  "26"  "27"  "28"  "29"  "30"  "31"  "32"  "33"  "34"  "35" 
-#>  [37] "36"  "37"  "38"  "39"  "40"  "41"  "42"  "43"  "44"  "45"  "46"  "47" 
-#>  [49] "48"  "49"  "50"  "51"  "52"  "53"  "54"  "55"  "56"  "57"  "58"  "59" 
-#>  [61] "60"  "61"  "62"  "63"  "64"  "65"  "66"  "67"  "68"  "69"  "70"  "71" 
-#>  [73] "72"  "73"  "74"  "75"  "76"  "77"  "78"  "79"  "80"  "81"  "82"  "83" 
-#>  [85] "84"  "85"  "86"  "87"  "88"  "89"  "90"  "91"  "92"  "93"  "94"  "95" 
-#>  [97] "96"  "97"  "98"  "99"  "100" "101" "102" "103" "104" "105" "106" "107"
-#> [109] "108" "109" "110" "111" "112" "113" "114" "115" "116" "117" "118" "119"
-#> [121] "120" "121" "122" "123" "124" "125" "126" "127" "128" "129" "130" "131"
-#> [133] "132" "133" "134" "135" "136" "137" "138" "139" "140" "141" "142" "143"
-#> [145] "144" "145" "146" "147" "148" "149" "150" "151" "152" "153" "154" "155"
-#> [157] "156" "157" "158" "159" "160" "161" "162" "163" "164" "165" "166" "167"
-#> [169] "168" "169" "170" "171" "172" "173" "174" "175" "176" "177" "178" "179"
-#> [181] "180" "181" "182" "183" "184" "185" "186" "187" "188" "189" "190" "191"
-#> [193] "192"
    aotus@sids   # sequence IDs
    #>    [1] "FJ623078.1"            "U38998.1"              "U88361.1"             
-#>    [4] "AY684995.1"            "AY684994.1"            "AY684993.1"           
-#>    [7] "AY684992.1/1..1422"    "AY684991.1/1..975"     "U88362.1"             
-#>   [10] "U88363.1"              "U88364.1"              "AY227074.1"           
-#>   [13] "AY227073.1"            "AY227072.1"            "AY227071.1"           
-#>   [16] "AY227070.1"            "AY227069.1"            "AY227068.1"           
-#>   [19] "AY227067.1"            "AY227066.1"            "AY227065.1"           
-#>   [22] "AY227064.1"            "AY227063.1"            "AY227062.1"           
-#>   [25] "AY227061.1"            "AY227060.1"            "AY227059.1"           
-#>   [28] "AY227058.1"            "AY227057.1"            "AY227056.1"           
-#>   [31] "AY227055.1"            "AY114513.1"            "AF201297.1/23..790"   
-#>   [34] "AF201296.1/23..790"    "AF201295.1/23..790"    "AF201294.1/23..790"   
-#>   [37] "AF201293.1/23..790"    "AF042146.1/11..370"    "AF042146.1/371..877"  
-#>   [40] "AF042144.1/11..370"    "AF042144.1/371..877"   "GQ280000.1"           
-#>   [43] "GQ279969.1"            "GQ279950.1"            "GQ279948.1"           
-#>   [46] "GQ279925.1"            "GQ279913.1"            "GQ279878.1"           
-#>   [49] "GQ279859.1"            "GQ279822.1"            "GQ279802.1"           
-#>   [52] "GQ279784.1"            "AY646198.1/152..1576"  "AF420045.1/255..1619" 
-#>   [55] "DM461196.1"            "DM461195.1"            "DM461194.1"           
-#>   [58] "DM461193.1"            "DM461192.1"            "DM461191.1"           
-#>   [61] "DM367551.1"            "DM367548.1"            "DM367545.1"           
-#>   [64] "DM367544.1"            "DM367543.1"            "DM367542.1"           
-#>   [67] "DM367541.1"            "DM367540.1"            "DM371283.1"           
-#>   [70] "DM371280.1"            "DM371276.1"            "DM371275.1"           
-#>   [73] "DM371274.1"            "DM371273.1"            "DM371272.1"           
-#>   [76] "DM371271.1"            "AB439577.1"            "DQ200808.1"           
-#>   [79] "DQ334827.1"            "AY449080.1"            "AY449079.1"           
-#>   [82] "AY449071.1"            "AY449070.1"            "AY449069.1"           
-#>   [85] "AY449065.1"            "AY449059.1"            "AY449058.1"           
-#>   [88] "AY449057.1"            "AY449013.1"            "AY449012.1"           
-#>   [91] "AY449011.1"            "AY449010.1"            "AY449009.1"           
-#>   [94] "AY455163.1"            "AY900569.1"            "AY900568.1"           
-#>   [97] "AY900563.1"            "AY900551.1"            "AY900525.1"           
-#>  [100] "AY947712.1/543..825"   "AB084909.2"            "AB084908.2"           
-#>  [103] "AB084907.2"            "AB081286.2"            "AB081285.2"           
-#>  [106] "AB081284.2"            "AB081283.2"            "AB081282.2"           
-#>  [109] "AB081281.2"            "AB081280.2"            "AB081279.2"           
-#>  [112] "AB081278.2"            "AB181216.1"            "AB181215.1"           
-#>  [115] "AB181214.1/283..580"   "AB181213.1"            "AB181212.1"           
-#>  [118] "AB181211.1/463..760"   "AB181210.1"            "AB181209.1"           
-#>  [121] "AB181208.1/452..749"   "AB181207.1"            "AY225806.1"           
-#>  [124] "AY225805.1"            "AY225802.1"            "AY225801.1"           
-#>  [127] "AY225800.1"            "AY225797.1"            "AJ489745.1"           
-#>  [130] "AJ489746.1"            "AB107211.1"            "AY246458.1"           
-#>  [133] "AF489256.1/1..298"     "AF489244.1/762..1058"  "AY055463.1"           
-#>  [136] "AF286383.1"            "U52114.1"              "AB023939.1"           
-#>  [139] "AB023938.1"            "AB023937.1"            "HM756917.1"           
-#>  [142] "HM756916.1"            "HM756841.1"            "HM756840.1"           
-#>  [145] "HM756839.1"            "HM756838.1"            "HM757001.1"           
-#>  [148] "HM757000.1"            "HM756999.1"            "HM757384.1"           
-#>  [151] "HM757383.1"            "HM757382.1"            "HM757381.1"           
-#>  [154] "HM757380.1"            "HM757379.1"            "HM757559.1"           
-#>  [157] "HM757558.1"            "HM757557.1"            "HM757556.1"           
-#>  [160] "HM757555.1"            "HM757554.1"            "HM757725.1"           
-#>  [163] "HM757724.1"            "HM757723.1"            "HM757722.1"           
-#>  [166] "HM757721.1"            "HM757720.1"            "HM757999.1"           
-#>  [169] "HM758217.1"            "HM758216.1"            "HM758215.1"           
-#>  [172] "HM758214.1"            "HM758213.1"            "HM758212.1"           
-#>  [175] "HM758450.1"            "HM758304.1"            "HM758303.1"           
-#>  [178] "HM758302.1"            "HM758297.1"            "HM758295.1"           
-#>  [181] "HM758476.1"            "HM758475.1"            "HM758466.1"           
-#>  [184] "HM758465.1"            "HM758464.1"            "HM758463.1"           
-#>  [187] "HM758660.1"            "HM758659.1"            "HM758658.1"           
-#>  [190] "HM758657.1"            "HM758656.1"            "HM758655.1"           
-#>  [193] "HM758650.1"            "HM758648.1"            "HM758935.1"           
-#>  [196] "HM758934.1"            "HM758933.1"            "HM758932.1"           
-#>  [199] "HM758931.1"            "HM758930.1"            "HM759106.1"           
-#>  [202] "HM759105.1"            "HM759104.1"            "HM759103.1"           
-#>  [205] "HM759102.1"            "HM759101.1"            "HM759279.1"           
-#>  [208] "HM759278.1"            "HM759277.1"            "HM759276.1"           
-#>  [211] "HM759275.1"            "HM759274.1"            "HM759273.1"           
-#>  [214] "HM759535.1"            "HM759379.1"            "HM759378.1"           
-#>  [217] "HM759377.1"            "HM759372.1"            "HM759370.1"           
-#>  [220] "HM759647.1"            "HM759646.1"            "HM759645.1"           
-#>  [223] "HM759644.1"            "HM759643.1"            "HM759641.1"           
-#>  [226] "HM759836.1"            "HM759819.1"            "HM759777.1"           
-#>  [229] "HM759775.1"            "HM759730.1"            "HM759729.1"           
-#>  [232] "HM760059.1"            "HM759903.1"            "HM759902.1"           
-#>  [235] "HM759901.1"            "HM759896.1"            "HM759894.1"           
-#>  [238] "HM760239.1"            "HM760087.1"            "HM760086.1"           
-#>  [241] "HM760085.1"            "HM760080.1"            "HM760078.1"           
-#>  [244] "HM760421.1"            "HM760263.1"            "HM760262.1"           
-#>  [247] "HM760261.1"            "HM760256.1"            "HM760254.1"           
-#>  [250] "HM760530.1"            "HM760529.1"            "HM760528.1"           
-#>  [253] "HM760527.1"            "HM760526.1"            "HM760525.1"           
-#>  [256] "HM760759.1"            "HM760615.1"            "HM760614.1"           
-#>  [259] "HM760613.1"            "HM760608.1"            "HM760606.1"           
-#>  [262] "HM760776.1"            "HM760775.1"            "HM760774.1"           
-#>  [265] "HM761014.1"            "HM761013.1"            "HM761012.1"           
-#>  [268] "HM761011.1"            "HM761146.1"            "HM761145.1"           
-#>  [271] "HM761144.1"            "HM761143.1"            "HM761207.1"           
-#>  [274] "HM761206.1"            "HM761196.1"            "HM761195.1"           
-#>  [277] "HM761194.1"            "HM761193.1"            "HM761664.1"           
-#>  [280] "HM761514.1"            "HM761513.1"            "HM761512.1"           
-#>  [283] "HM761507.1"            "HM761505.1"            "HM761773.1"           
-#>  [286] "HM761772.1"            "HM761771.1"            "HM761770.1"           
-#>  [289] "HM761769.1"            "HM761768.1"            "HM761930.1"           
-#>  [292] "HM761929.1"            "HM761928.1"            "HM761927.1"           
-#>  [295] "HM761926.1"            "HM761925.1"            "HM762097.1"           
-#>  [298] "HM762096.1"            "HM762095.1"            "HM762094.1"           
-#>  [301] "HM762093.1"            "HM762092.1"            "HM762324.1"           
-#>  [304] "HM762245.1"            "HM762207.1"            "HM762199.1"           
-#>  [307] "HM762181.1"            "HM762180.1"            "HM762432.1"           
-#>  [310] "HM762431.1"            "HM762430.1"            "HM762429.1"           
-#>  [313] "HM762428.1"            "HM762427.1"            "HM762674.1"           
-#>  [316] "HM762517.1"            "HM762516.1"            "HM762511.1"           
-#>  [319] "HM762509.1"            "HM762770.1"            "HM762769.1"           
-#>  [322] "HM762768.1"            "HM762767.1"            "HM762766.1"           
-#>  [325] "HM762765.1"            "HM762863.1"            "HM762862.1"           
-#>  [328] "HM762858.1"            "HM762856.1"            "HM763022.1"           
-#>  [331] "HM763021.1"            "HM763020.1"            "HM763019.1"           
-#>  [334] "HM763266.1"            "HM763265.1"            "HM763264.1"           
-#>  [337] "HM763263.1"            "HM763262.1"            "HM763261.1"           
-#>  [340] "HM763434.1"            "HM763433.1"            "HM763432.1"           
-#>  [343] "HM763431.1"            "HM763430.1"            "HM763429.1"           
-#>  [346] "HM763505.1"            "HM763504.1"            "HM763503.1"           
-#>  [349] "HM763727.1"            "HM763726.1"            "HM763725.1"           
-#>  [352] "HM763724.1"            "HM763723.1"            "HM763722.1"           
-#>  [355] "HM763846.1"            "HM763845.1"            "HM763844.1"           
-#>  [358] "HM763997.1"            "HM763996.1"            "HM763995.1"           
-#>  [361] "HM763994.1"            "HM764215.1"            "HM764188.1"           
-#>  [364] "HM764187.1"            "HM764105.1"            "HM764104.1"           
-#>  [367] "HM764102.1"            "HM764322.1"            "HM764321.1"           
-#>  [370] "HM764320.1"            "HM764319.1"            "HM764318.1"           
-#>  [373] "HM764317.1"            "HM764402.1"            "HM764401.1"           
-#>  [376] "HM764396.1"            "HM764394.1"            "HM764649.1"           
-#>  [379] "HM764648.1"            "HM764647.1"            "HM764646.1"           
-#>  [382] "HM764645.1"            "HM764817.1"            "HM764816.1"           
-#>  [385] "HM764815.1"            "HM764814.1"            "HM764813.1"           
-#>  [388] "HM765068.1"            "HM764910.1"            "HM764909.1"           
-#>  [391] "HM764908.1"            "HM764903.1"            "HM764901.1"           
-#>  [394] "HM765180.1"            "HM765179.1"            "HM765178.1"           
-#>  [397] "HM765177.1"            "HM765176.1"            "HM765175.1"           
-#>  [400] "AB181223.1/324..589"   "AB181222.1/324..589"   "AB181222.1/1555..1849"
-#>  [403] "AB181217.1/324..590"   "AB181217.1/1545..1839" "FJ638418.1"           
-#>  [406] "FJ638417.1"            "FJ638416.1"            "FJ638415.1"           
-#>  [409] "FJ638414.1"            "JQ932362.1"            "JQ932359.1"           
-#>  [412] "JQ932356.1"            "JQ932319.1"            "JQ932318.1"           
-#>  [415] "JQ932310.1"            "JQ932304.1"            "JQ932303.1"           
-#>  [418] "JQ932293.1"            "JQ932280.1"            "JQ932259.1"           
-#>  [421] "JQ932255.1"            "JQ932245.1"            "JQ932232.1"           
-#>  [424] "DQ098868.1"            "DQ098867.1"            "AY455164.1"           
-#>  [427] "AY455162.1"            "AY455159.1"            "AY455158.1"           
-#>  [430] "AY455153.1"            "AF169487.1"            "AF169486.1"           
-#>  [433] "AF169485.1"            "AF042145.1/1..355"     "AF042145.1/356..862"  
-#>  [436] "U59646.1"              "U59645.1"              "U59644.1"             
-#>  [439] "U36845.1"              "U36844.1"              "U36843.1"             
-#>  [442] "U36846.1"              "U36770.1"              "JF444279.1"           
-#>  [445] "JN161098.1"            "JN161097.1"            "JN161096.1"           
-#>  [448] "JN161095.1"            "JN161094.1"            "JN161093.1"           
-#>  [451] "JN161092.1"            "JN161091.1"            "JN161090.1"           
-#>  [454] "JN161089.1"            "JN161088.1"            "JN161087.1"           
-#>  [457] "JN161086.1"            "JN161085.1"            "JN161084.1"           
-#>  [460] "JN161083.1"            "JN161082.1"            "JN161081.1"           
-#>  [463] "JN161080.1"            "JN161079.1"            "JN161078.1"           
-#>  [466] "JN161077.1"            "JN161076.1"            "JN161075.1"           
-#>  [469] "JN161074.1"            "JN161073.1"            "JN161072.1"           
-#>  [472] "JN161071.1"            "JN161070.1"            "JN161069.1"           
-#>  [475] "JQ932775.1"            "JQ932756.1"            "JQ932751.1"           
-#>  [478] "JQ932724.1"            "JQ932717.1"            "JQ932662.1"           
-#>  [481] "JQ932636.1"            "JQ932630.1"            "JQ932605.1"           
-#>  [484] "JQ932597.1"            "JQ932590.1"            "JQ933099.1"           
-#>  [487] "JQ933082.1"            "JQ933076.1"            "JQ933075.1"           
-#>  [490] "JQ933053.1"            "JQ933029.1"            "JQ933028.1"           
-#>  [493] "JQ933027.1"            "JQ933026.1"            "JQ933023.1"           
-#>  [496] "JQ933020.1"            "JQ933011.1"            "JQ933006.1"           
-#>  [499] "JQ933005.1"            "JQ933004.1"            "JQ933001.1"           
-#>  [502] "JQ933000.1"            "JQ932999.1"            "JQ932998.1"           
-#>  [505] "JQ932997.1"            "JQ932996.1"            "JQ932995.1"           
-#>  [508] "JQ932994.1"            "JQ932993.1"            "JQ932992.1"           
-#>  [511] "JQ932991.1"            "JQ932990.1"            "JQ932989.1"           
-#>  [514] "JQ932988.1"            "JQ932987.1"            "JQ932986.1"           
-#>  [517] "JQ932985.1"            "JQ932984.1"            "JQ932983.1"           
-#>  [520] "JQ932982.1"            "JQ932981.1"            "JQ932980.1"           
-#>  [523] "JQ932979.1"            "JQ932978.1"            "JQ932977.1"           
-#>  [526] "JQ932976.1"            "JQ932975.1"            "JQ932974.1"           
-#>  [529] "JQ932973.1"            "JQ932972.1"            "JQ932971.1"           
-#>  [532] "JQ932970.1"            "JQ932969.1"            "JQ932967.1"           
-#>  [535] "JQ932966.1"            "JQ932965.1"            "JQ932964.1"           
-#>  [538] "JQ932963.1"            "JQ932962.1"            "JQ932961.1"           
-#>  [541] "JQ932960.1"            "JQ932959.1"            "JQ932958.1"           
-#>  [544] "JQ932957.1"            "JQ932956.1"            "JQ932955.1"           
-#>  [547] "JQ932954.1"            "JQ932953.1"            "JQ932934.1"           
-#>  [550] "JQ932933.1"            "JQ932932.1"            "JQ932931.1"           
-#>  [553] "JQ932930.1"            "JQ932929.1"            "JQ932928.1"           
-#>  [556] "JQ932927.1"            "JQ932926.1"            "JQ932925.1"           
-#>  [559] "JQ932924.1"            "JQ932923.1"            "JQ932922.1"           
-#>  [562] "JQ932921.1"            "JQ932920.1"            "JQ932918.1"           
-#>  [565] "JQ932916.1"            "JQ932914.1"            "JQ932913.1"           
-#>  [568] "JQ932909.1"            "JQ932908.1"            "JQ932905.1"           
-#>  [571] "JQ932903.1"            "JQ932897.1"            "JQ932896.1"           
-#>  [574] "JQ932895.1"            "JQ932892.1"            "JQ932891.1"           
-#>  [577] "JQ932890.1"            "JQ932889.1"            "JQ932888.1"           
-#>  [580] "JQ932887.1"            "JQ932886.1"            "JQ932885.1"           
-#>  [583] "JQ932884.1"            "JQ932882.1"            "JQ932881.1"           
-#>  [586] "JQ932880.1"            "JQ932879.1"            "JQ932877.1"           
-#>  [589] "JQ932874.1"            "JQ932873.1"            "JQ932872.1"           
-#>  [592] "JQ932870.1"            "JQ932869.1"            "JQ932868.1"           
-#>  [595] "JQ932867.1"            "JQ932866.1"            "JQ932865.1"           
-#>  [598] "JQ932864.1"            "JQ932863.1"            "JQ932862.1"           
-#>  [601] "JQ932861.1"            "JQ932859.1"            "JQ932857.1"           
-#>  [604] "JQ932856.1"            "JQ932855.1"            "JQ932854.1"           
-#>  [607] "JQ932853.1"            "JQ932852.1"            "JQ932851.1"           
-#>  [610] "JQ932850.1"            "JQ932849.1"            "JQ932847.1"           
-#>  [613] "JQ932846.1"            "JQ932845.1"            "JQ932844.1"           
-#>  [616] "JQ932843.1"            "JQ932842.1"            "JQ932841.1"           
-#>  [619] "JQ932840.1"            "JQ932839.1"            "JQ932838.1"           
-#>  [622] "JQ932837.1"            "JQ932836.1"            "JQ932835.1"           
-#>  [625] "JQ932833.1"            "JQ932831.1"            "JQ932830.1"           
-#>  [628] "JQ932829.1"            "JQ932827.1"            "JQ932823.1"           
-#>  [631] "JQ932822.1"            "JQ932821.1"            "JQ932818.1"           
-#>  [634] "JQ932817.1"            "JQ932816.1"            "JQ932815.1"           
-#>  [637] "JQ932814.1"            "JQ932813.1"            "JQ932812.1"           
-#>  [640] "JQ932809.1"            "JQ932807.1"            "JQ932806.1"           
-#>  [643] "JQ932805.1"            "JQ932804.1"            "JQ932803.1"           
-#>  [646] "JQ932802.1"            "JQ932801.1"            "JQ932800.1"           
-#>  [649] "JQ932799.1"            "JQ932794.1"            "KC760418.1"           
-#>  [652] "KC760417.1"            "KC760388.1"            "KC760387.1"           
-#>  [655] "KC760386.1"            "KC760385.1"            "KC760329.1"           
-#>  [658] "KC760328.1"            "KC760327.1"            "KC760326.1"           
-#>  [661] "KC760297.1"            "KC760296.1"            "KC760295.1"           
-#>  [664] "KC760266.1"            "KC760265.1"            "KC760264.1"           
-#>  [667] "KC760263.1"            "KC760231.1"            "KC760230.1"           
-#>  [670] "KC760229.1"            "KC760228.1"            "AB762011.1"           
-#>  [673] "AB762010.1"            "AB762009.1"            "AB762008.1"           
-#>  [676] "AB762007.1"            "AB762006.1"            "AB762005.1"           
-#>  [679] "AB762004.1"            "AB762003.1"            "AB762002.1"           
-#>  [682] "AB762001.1"            "AB762000.1"            "AB761999.1"           
-#>  [685] "AB761998.1"            "AB761997.1"            "AB761996.1"           
-#>  [688] "AB761995.1"            "AB761994.1"            "AB761993.1"           
-#>  [691] "AB761992.1"            "AB761991.1"            "AB761990.1"           
-#>  [694] "AB761989.1"            "AB761988.1"            "AB761987.1"           
-#>  [697] "AB761986.1"            "HW478260.1"            "HW478259.1"           
-#>  [700] "HW478258.1"            "HW478257.1"            "HW478256.1"           
-#>  [703] "HW478255.1"            "KF014088.1"            "KF014089.1"           
-#>  [706] "KF014091.1/1..1059"    "KF014090.1/1..1059"    "KF014094.1"           
-#>  [709] "KF014093.1"            "KF014092.1"            "KF014098.1/1..1017"   
-#>  [712] "KF014097.1/1..1122"    "KF014096.1/1..1209"    "KF014095.1/1..1104"   
-#>  [715] "KF014103.1"            "KF014102.1"            "KF014101.1"           
-#>  [718] "KF014100.1"            "KF014099.1/1..1332"    "KF014105.1/1..1113"   
-#>  [721] "KF014104.1"            "KF014106.1/1..1212"    "KF014108.1/1..927"    
-#>  [724] "KF014107.1/1..1014"    "KF014109.1"            "KF014110.1/1..1110"   
-#>  [727] "KF014113.1"            "KF014112.1"            "KF014111.1"           
-#>  [730] "KF014116.1"            "KF014115.1"            "KF014114.1"           
-#>  [733] "KF014117.1/1..1263"    "KF014118.1"            "KF014119.1"           
-#>  [736] "KF014120.1/1..1395"    "KF014122.1/1..978"     "KF014121.1/1..1110"   
-#>  [739] "DI178960.1"            "DI178959.1"            "DI178958.1"           
-#>  [742] "DI178957.1"            "DI178956.1"            "DI178955.1"           
-#>  [745] "DI178127.1"            "DI178124.1"            "DI178120.1"           
-#>  [748] "DI178119.1"            "DI178118.1"            "DI178117.1"           
-#>  [751] "DI178116.1"            "DI178115.1"            "AB239248.1"           
-#>  [754] "AB239247.1"            "AB239246.1"            "AB239228.1"           
-#>  [757] "AB239227.1"            "AB239226.1"            "AB239203.1"           
-#>  [760] "AB239202.1"            "AB239201.1"            "AB239200.1"           
-#>  [763] "JQ963361.1"            "JQ963360.1"            "JQ963351.1"           
-#>  [766] "JQ963350.1"            "JQ963349.1"            "JQ963348.1"           
-#>  [769] "JQ963347.1"            "JQ963346.1"            "JQ933101.1"           
-#>  [772] "AY114530.1"            "AY114529.1"            "AY114528.1"           
-#>  [775] "AY114527.1"            "AY114526.1"            "AY114525.1"           
-#>  [778] "AY114524.1"            "AY114523.1"            "AY114522.1"           
-#>  [781] "AY114521.1"            "AY114520.1"            "AY114519.1"           
-#>  [784] "AY114518.1"            "AY114517.1"            "AY114516.1"           
-#>  [787] "AY114515.1"            "AY114514.1"            "AF486450.1"           
-#>  [790] "AF486449.1"            "AF486448.1"            "AF181085.1"           
-#>  [793] "AF004921.1"            "AF027569.1"            "AF027567.1"           
-#>  [796] "AF027566.1"            "AF027565.1"            "AF027564.1"           
-#>  [799] "AF027563.1"            "AF027562.1"            "AF027561.1/1..298"    
-#>  [802] "AF027560.1"            "AF027559.1"            "AF027554.1/1..256"    
-#>  [805] "AF027553.1"            "AF027552.1"            "AF027551.1"           
-#>  [808] "AF027549.1"            "AF027548.1"            "AF027547.1"           
-#>  [811] "AF027546.1/1..274"     "AF027545.1"            "AF027544.1"           
-#>  [814] "AF027543.1/1..265"     "AF027542.1"            "EF658656.1"           
-#>  [817] "EF658655.1"            "EF658654.1"            "EF658653.1"           
-#>  [820] "EF658652.1"            "DQ989366.1"            "AH006732.3/455..733"  
-#>  [823] "AH006511.2/455..733"   "KR528418.1/1..1140"    "KM206808.1"           
-#>  [826] "KM206805.1"            "KM206804.1"            "KC762196.1"           
-#>  [829] "KC762195.1"            "KC762194.1"            "KC762193.1"           
-#>  [832] "KC762163.1"            "KC762162.1"            "KC762161.1"           
-#>  [835] "KC762160.1"            "KC762129.1"            "KC762128.1"           
-#>  [838] "KC762127.1"            "KC762106.1"            "KC762105.1"           
-#>  [841] "KC762104.1"            "KC762075.1"            "KC762074.1"           
-#>  [844] "KC762073.1"            "KC762072.1"            "KC762017.1"           
-#>  [847] "KC762016.1"            "KC762015.1"            "KC762014.1"           
-#>  [850] "KC761983.1"            "KC761982.1"            "KC761981.1"           
-#>  [853] "KC761980.1"            "KC761954.1"            "KC761953.1"           
-#>  [856] "KC761952.1"            "KC761951.1"            "KC761921.1"           
-#>  [859] "KC761920.1"            "KC761919.1"            "KC761918.1"           
-#>  [862] "KC761892.1"            "KC761891.1"            "KC761890.1"           
-#>  [865] "KC761889.1"            "KC761836.1"            "KC761835.1"           
-#>  [868] "KC761834.1"            "KC761833.1"            "KC761816.1"           
-#>  [871] "KC761815.1"            "KC761814.1"            "KC761813.1"           
-#>  [874] "KC761785.1"            "KC761784.1"            "KC761783.1"           
-#>  [877] "KC761782.1"            "KC761757.1"            "KC761756.1"           
-#>  [880] "KC761755.1"            "KC761698.1"            "KC761697.1"           
-#>  [883] "KC761696.1"            "KC761695.1"            "KC761635.1"           
-#>  [886] "KC761634.1"            "KC761633.1"            "KC761632.1"           
-#>  [889] "KC761604.1"            "KC761603.1"            "KC761602.1"           
-#>  [892] "KC761601.1"            "KC761572.1"            "KC761571.1"           
-#>  [895] "KC761570.1"            "KC761569.1"            "KC761540.1"           
-#>  [898] "KC761539.1"            "KC761538.1"            "KC761537.1"           
-#>  [901] "KC761507.1"            "KC761506.1"            "KC761505.1"           
-#>  [904] "KC761504.1"            "KC761473.1"            "KC761472.1"           
-#>  [907] "KC761471.1"            "KC761470.1"            "KC761440.1"           
-#>  [910] "KC761439.1"            "KC761438.1"            "KC761408.1"           
-#>  [913] "KC761407.1"            "KC761406.1"            "KC761405.1"           
-#>  [916] "KC761373.1"            "KC761372.1"            "KC761371.1"           
-#>  [919] "KC761340.1"            "KC761339.1"            "KC761338.1"           
-#>  [922] "KC761279.1"            "KC761278.1"            "KC761277.1"           
-#>  [925] "KC761245.1"            "KC761244.1"            "KC761243.1"           
-#>  [928] "KC761242.1"            "KC761212.1"            "KC761211.1"           
-#>  [931] "KC761210.1"            "KC761180.1"            "KC761179.1"           
-#>  [934] "KC761178.1"            "KC761177.1"            "KC761146.1"           
-#>  [937] "KC761145.1"            "KC761144.1"            "KC761112.1"           
-#>  [940] "KC761111.1"            "KC761083.1"            "KC761082.1"           
-#>  [943] "KC761081.1"            "KC761080.1"            "KC761053.1"           
-#>  [946] "KC761052.1"            "KC761051.1"            "KC761050.1"           
-#>  [949] "KC761019.1"            "KC761018.1"            "KC761017.1"           
-#>  [952] "KC761016.1"            "KC760991.1"            "KC760990.1"           
-#>  [955] "KC760989.1"            "KC760988.1"            "KC760957.1"           
-#>  [958] "KC760956.1"            "KC760955.1"            "KC760954.1"           
-#>  [961] "KC760922.1"            "KC760921.1"            "KC760920.1"           
-#>  [964] "KC760894.1"            "KC760893.1"            "KC760892.1"           
-#>  [967] "KC760891.1"            "KC760869.1"            "KC760868.1"           
-#>  [970] "KC760867.1"            "KC760866.1"            "KC760836.1"           
-#>  [973] "KC760835.1"            "KC760834.1"            "KC760833.1"           
-#>  [976] "KC760805.1"            "KC760804.1"            "KC760803.1"           
-#>  [979] "KC760802.1"            "KC760772.1"            "KC760771.1"           
-#>  [982] "KC760770.1"            "KC760741.1"            "KC760740.1"           
-#>  [985] "KC760739.1"            "KC760738.1"            "KC760715.1"           
-#>  [988] "KC760714.1"            "KC760713.1"            "KC760712.1"           
-#>  [991] "KC760684.1"            "KC760683.1"            "KC760682.1"           
-#>  [994] "KC760681.1"            "KC760649.1"            "KC760648.1"           
-#>  [997] "KC760647.1"            "KC760646.1"            "KC760614.1"           
-#> [1000] "KC760613.1"           
-#>  [ reached getOption("max.print") -- omitted 499 entries ]
    aotus@txids  # taxonomic IDs
    #>  [1] "37293"   "9505"    "57176"   "57175"   "43147"   "231953"  "30591"  
-#>  [8] "280755"  "867331"  "292213"  "1002694" "120088"  "361674" 
    aotus@clstrs # clusters archive
    #> Archive of cluster record(s)
-#>  - [193] clusters
    aotus@sqs    # sequence archive
    #> Archive of sequence record(s)
-#>  - [1499] sequences
-#>  - [13] unique txids
-#>  - [548] median sequence length
-#>  - [0] median ambiguous nucleotides
    aotus@txdct  # taxonomic dictionary
    #> Taxonomic dictionary [21] recs, parent [id 9504]
    # see all of the available slots
-(slotNames(aotus))
    #> [1] "cids"    "txids"   "sids"    "txdct"   "sqs"     "clstrs"  "prnt_id"
-#> [8] "prnt_nm"
    # access different sequences and clusters with [[
-(aotus[['0']])              # cluster record 0
    #> Cluster Record [id 0]
-#>  - [subtree] type
-#>  - [AF129794.1] seed sequence
-#>  - [204] sequences
-#>  - [5] taxa
    (aotus[[aotus@sids[[1]]]])  # first sequence record
    #> SeqRec [ID: FJ623078.1]
    # get a summary of the whole object
-(summary(aotus))
    #>      ID    Type                   Seed Parent N_taxa N_seqs Med_sql       MAD
-#> 1     0 subtree             AF129794.1   9504      5    204   267.0 0.7124669
-#> 2     1 subtree               U52114.1   9504      5     63  1020.0 0.7604098
-#> 3     2 subtree             DI178118.1   9504      2     52   267.0 0.8666904
-#> 4     3 subtree             JQ932794.1   9504      4     43   568.0 0.6643121
-#> 5     4 subtree               U36844.1   9504      9     41   549.0 0.8397112
-#> 6     5 subtree     KF014117.1/1..1263   9504      1     35  1281.0 0.7731248
-#> 7     6 subtree             LC075891.1   9504      2     33   838.0 0.8026216
-#> 8     7 subtree             JN161069.1   9504      1     30  1088.0 0.9985614
-#> 9     8 subtree             JN161069.1  30591      1     30  1088.0 0.9985614
-#> 10    9 subtree             AJ489745.1   9504     10     29  1140.0 1.0000000
-#> 11   10 subtree             AF333711.1   9504      1     28   394.0 0.9228029
-#> 12   11  direct             LC075891.1  30591      1     26   839.0 0.8095820
-#> 13   12 subtree             JQ932884.1   9504      4     24   760.0 0.7909620
-#> 14   13 subtree             AF378747.1   9504      1     20   364.0 0.8938575
-#> 15   14 subtree             JQ932881.1   9504      4     19   521.0 0.7978981
-#> 16   15 subtree             AY900546.1   9504      1     19   290.0 0.6804250
-#> 17   16 subtree             JQ932999.1   9504      1     18   633.0 0.6914067
-#> 18   17 subtree             AF027542.1   9504      1     18   287.0 0.8037759
-#> 19   18 subtree             AF333712.1   9504      1     18   378.0 0.9713542
-#> 20   19 subtree             JQ932845.1   9504      4     17   588.0 0.6802310
-#> 21   20 subtree             JQ933027.1   9504      2     16   789.5 0.8442383
-#> 22   21 subtree             JQ932800.1   9504      4     14   633.0 0.7108335
-#> 23   22 subtree             DQ321662.1  30591      2     13   549.0 0.8050398
-#> 24   23 subtree             JQ932874.1   9504      1     12   543.5 0.8983452
-#> 25   24 subtree             KY508404.1   9504      1     12   411.5 0.9586317
-#> 26   25 subtree             JQ932840.1   9504      1     11   565.0 0.8977661
-#> 27   26 subtree             AF107750.1   9504      1     11   323.0 0.9789997
-#> 28   27  direct             AB761995.1  30591      1     11   785.0 0.8737194
-#> 29   28 subtree             JQ932868.1   9504      2     10   561.0 0.7707880
-#> 30   29 subtree    AF338374.1/177..829   9504      8     10   653.0 0.9658499
-#> 31   30 subtree             LC075890.1   9504      2     10   853.5 0.8719880
-#> 32   31 subtree             AY972694.1   9504      4     10   629.0 0.9725881
-#> 33   32 subtree             AY894647.1   9504      1     10  1170.0 0.9992314
-#> 34   33 subtree             JQ932807.1   9504      1      9   637.0 0.7393674
-#> 35   34 subtree     AF042144.1/11..370   9504      3      8   326.0 0.8920139
-#> 36   35 subtree             AY900559.1   9504      1      8   280.0 0.7162162
-#> 37   36 subtree             HM758648.1   9504      6      8   680.0 0.9605078
-#> 38   37 subtree             JQ932913.1   9504      1      7   754.0 0.8016142
-#> 39   38 subtree             AY449013.1   9504      1      7   685.0 1.0000000
-#> 40   39 subtree             AY900538.1   9504      1      7   315.0 0.9235474
-#> 41   40 subtree             HM759273.1   9504      6      7   715.0 0.9858142
-#> 42   41  direct             AY449013.1  30591      1      7   685.0 1.0000000
-#> 43   42  direct             EF658652.1  30591      1      7   629.0 0.9754224
-#> 44   43 subtree             DQ098867.1  30591      2      7  1140.0 1.0000000
-#> 45   44 subtree NM_001308532.1/14..457   9504      4      6   465.0 0.9698925
-#> 46   45 subtree   AY646198.1/152..1576   9504      1      6  1405.5 0.8877193
-#> 47   46 subtree     AF201293.1/23..790   9504      1      6   768.0 1.0000000
-#> 48   47 subtree             GQ279878.1   9504      4      6   663.0 0.8277405
-#> 49   48 subtree             KC761051.1   9504      4      6   473.5 0.6922778
-#> 50   49 subtree             GQ279822.1   9504      4      6   578.0 0.7239464
-#> 51   50 subtree             HM756838.1   9504      6      6   552.0 0.9782738
-#> 52   51 subtree             HM757379.1   9504      6      6   612.0 0.9945534
-#> 53   52 subtree             HM757554.1   9504      6      6   475.0 0.9361404
-#> 54   53 subtree             HM757720.1   9504      6      6   899.0 0.9713971
-#> 55   54 subtree             HM758212.1   9504      6      6   341.0 0.9961014
-#> 56   55 subtree             HM758295.1   9504      6      6   636.0 0.9873776
-#> 57   56 subtree             HM758463.1   9504      6      6   590.0 0.9818182
-#> 58   57 subtree             HM758930.1   9504      6      6   505.5 0.7809254
-#> 59   58 subtree             HM759101.1   9504      6      6  1077.0 0.9996905
-#> 60   59 subtree             HM759370.1   9504      6      6   611.0 0.9763458
-#> 61   60 subtree             HM759641.1   9504      6      6   323.0 0.9343434
-#> 62   61 subtree             HM759729.1   9504      6      6   355.0 0.9737089
-#> 63   62 subtree             HM759894.1   9504      6      6   579.0 0.9408517
-#> 64   63 subtree             HM760078.1   9504      6      6   585.5 0.9216172
-#> 65   64 subtree             HM760254.1   9504      6      6   538.0 0.9959877
-#> 66   65 subtree             HM760525.1   9504      6      6   555.5 0.9838420
-#> 67   66 subtree             HM760606.1   9504      6      6   660.0 0.9917044
-#> 68   67 subtree             HM761193.1   9504      6      6   617.0 0.9767565
-#> 69   68 subtree             HM761505.1   9504      6      6   552.5 0.9365910
-#> 70   69 subtree             HM761768.1   9504      6      6   475.5 0.9530271
-#> 71   70 subtree             HM761925.1   9504      6      6   714.5 0.9683830
-#> 72   71 subtree             HM762092.1   9504      6      6   719.5 0.9822404
-#> 73   72 subtree             HM762180.1   9504      6      6   761.0 0.9868594
-#> 74   73 subtree             HM762427.1   9504      6      6   958.5 0.9632826
-#> 75   74 subtree             HM762765.1   9504      6      6   602.0 0.9706840
-#> 76   75 subtree             HM763261.1   9504      6      6  1000.0 0.9960000
-#> 77   76 subtree             HM763429.1   9504      6      6   399.0 0.9473039
-#> 78   77 subtree             HM763727.1   9504      6      6  1245.0 0.9453793
-#> 79   78 subtree             HM764102.1   9504      6      6   994.5 0.9774549
-#> 80   79 subtree             HM764317.1   9504      6      6   951.0 0.9584648
-#> 81   80 subtree             HM764901.1   9504      6      6   489.5 0.9824916
-#> 82   81 subtree             HM765175.1   9504      6      6   411.5 0.9233253
-#> 83   82 subtree             GQ279948.1   9504      3      5   464.0 0.7594512
-#> 84   83 subtree             HM762509.1   9504      5      5   521.0 0.9712644
-#> 85   84 subtree             HM764645.1   9504      5      5   674.0 0.9609467
-#> 86   85 subtree             HM764813.1   9504      5      5   573.0 0.9892734
-#> 87   86 subtree             FJ638414.1   9504      3      5   576.0 1.0000000
-#> 88   87 subtree             JQ933005.1   9504      1      5   878.0 0.9155983
-#> 89   88 subtree             JQ932259.1   9504      1      5   868.0 0.9529944
-#> 90   89 subtree             JQ932280.1   9504      4      5   554.0 0.7180095
-#> 91   90 subtree             JQ932662.1   9504      4      5   677.0 0.8219626
-#> 92   91 subtree             JQ932630.1   9504      1      5   843.0 0.8923251
-#> 93   92 subtree             JQ932880.1   9504      1      5   556.0 0.8463190
-#> 94   93 subtree             DQ989366.1   9504      5      5   428.0 0.9439252
-#> 95   94 subtree             FJ623078.1   9504      3      4  1374.0 1.0000000
-#> 96   95 subtree             DQ334827.1   9504      2      4  1196.5 0.7261749
-#> 97   96 subtree    AF042144.1/371..877   9504      2      4   507.0 0.9930966
-#> 98   97 subtree  AB181217.1/1545..1839   9504      4      4   296.5 0.5401961
-#> 99   98 subtree   AF397604.1/737..1037   9504      2      4   372.0 0.7777778
-#> 100  99 subtree             AY449010.1   9504      1      4   667.0 1.0000000
-#>                            Definition                            Feature
-#> 1        aotus (0.07), partial (0.07)       aovodrb (0.5), aonadrb (0.5)
-#> 2          aotus (0.09), class (0.09)                           mhcf (1)
-#> 3   antibody (0.05), construct (0.05)                 jp (0.3), kr (0.2)
-#> 4          aotus (0.2), genomic (0.2)                                  -
-#> 5     gene (0.1), mitochondrial (0.1)                           coii (1)
-#> 6         allele (0.08), aotus (0.08)       kir3ds3 (0.2), kir2ds5 (0.1)
-#> 7              dna (0.1), aotus (0.1)                                  -
-#> 8           azarai (0.2), aotus (0.1)                                  -
-#> 9           azarai (0.2), aotus (0.1)                                  -
-#> 10      aotus (0.1), cytochrome (0.1)       cytb (0.4), cytochrome (0.3)
-#> 11           aotus (0.08), cds (0.08)                                  -
-#> 12             dna (0.2), aotus (0.1)                                  -
-#> 13         aotus (0.2), genomic (0.2)                                  -
-#> 14           aotus (0.08), cds (0.08)                                  -
-#> 15         aotus (0.2), genomic (0.2)                                  -
-#> 16         aotus (0.08), chain (0.08)                                  -
-#> 17         aotus (0.2), genomic (0.2)                                  -
-#> 18         alpha (0.09), aotus (0.09)      rearrangement (0.5), vj (0.5)
-#> 19           aotus (0.09), cds (0.09)                                  -
-#> 20         aotus (0.2), genomic (0.2)                                  -
-#> 21         aotus (0.1), azarai (0.08)                                  -
-#> 22         aotus (0.2), genomic (0.2)                                  -
-#> 23          azarai (0.1), gene (0.08)                                  -
-#> 24         aotus (0.2), genomic (0.2)                                  -
-#> 25        sequence (0.2), aotus (0.1)                                  -
-#> 26         aotus (0.2), genomic (0.2)                                  -
-#> 27          aotus (0.08), beta (0.08)                                  -
-#> 28          aotus (0.1), azarai (0.1)                                  -
-#> 29         aotus (0.2), genomic (0.2)                                  -
-#> 30             sry (0.2), aotus (0.1)                            sry (1)
-#> 31        aotus (0.1), sequence (0.1)                                  -
-#> 32           aotus (0.08), cds (0.08)                        barcode (1)
-#> 33           aotus (0.1), clone (0.1)                                  -
-#> 34         aotus (0.2), genomic (0.2)                                  -
-#> 35            aotus (0.1), mrna (0.1)          aotusb2m (0.5), b2m (0.5)
-#> 36         aotus (0.08), chain (0.08)                                  -
-#> 37            aotus (0.1), gene (0.1)                                  -
-#> 38         aotus (0.2), genomic (0.2)                                  -
-#> 39          azarai (0.1), clone (0.1)                                  -
-#> 40         aotus (0.09), chain (0.09)                                  -
-#> 41         aotus (0.1), dennd5a (0.1)                                  -
-#> 42          azarai (0.1), clone (0.1)                                  -
-#> 43        aotus (0.08), azarai (0.08)                                  -
-#> 44             aotus (0.1), cds (0.1)                                  -
-#> 45             aotus (0.2), il2 (0.2)                            il2 (1)
-#> 46             aotus (0.1), cds (0.1)          of (0.1), activity (0.07)
-#> 47       antigen (0.08), aotus (0.08) aonadqa1 (0.8), loc105708941 (0.2)
-#> 48         aotus (0.2), genomic (0.2)                                  -
-#> 49         aotus (0.2), genomic (0.2)                                  -
-#> 50         aotus (0.2), genomic (0.2)                                  -
-#> 51            aotus (0.1), gene (0.1)                                  -
-#> 52            aotus (0.1), gene (0.1)                                  -
-#> 53            aotus (0.1), gene (0.1)                                  -
-#> 54            aotus (0.1), gene (0.1)                                  -
-#> 55            aotus (0.1), gene (0.1)                                  -
-#> 56            aotus (0.1), gene (0.1)                                  -
-#> 57            aotus (0.1), gene (0.1)                                  -
-#> 58            aotus (0.1), gene (0.1)                                  -
-#> 59            aotus (0.1), gene (0.1)                                  -
-#> 60            aotus (0.1), gene (0.1)                                  -
-#> 61            aotus (0.1), gene (0.1)                                  -
-#> 62            aotus (0.1), gene (0.1)                                  -
-#> 63            aotus (0.1), gene (0.1)                                  -
-#> 64            aotus (0.1), gene (0.1)                                  -
-#> 65            aotus (0.1), gene (0.1)                                  -
-#> 66            aotus (0.1), gene (0.1)                                  -
-#> 67            aotus (0.1), gene (0.1)                                  -
-#> 68            aotus (0.1), gene (0.1)                                  -
-#> 69           aotus (0.1), foxp1 (0.1)                                  -
-#> 70             aotus (0.1), fes (0.1)                                  -
-#> 71            aotus (0.1), fbn1 (0.1)                                  -
-#> 72         aotus (0.1), fam123b (0.1)                                  -
-#> 73            aotus (0.1), erc2 (0.1)                                  -
-#> 74            aotus (0.1), edg1 (0.1)                                  -
-#> 75           aotus (0.1), dctn2 (0.1)                                  -
-#> 76            aotus (0.1), cnr1 (0.1)                                  -
-#> 77          aotus (0.1), chrna1 (0.1)                                  -
-#> 78           aotus (0.1), brca2 (0.1)                                  -
-#> 79            aotus (0.1), bche (0.1)                                  -
-#> 80           aotus (0.1), axin1 (0.1)                                  -
-#> 81            aff2 (0.1), aotus (0.1)                                  -
-#> 82          adora3 (0.1), aotus (0.1)                                  -
-#> 83         aotus (0.2), genomic (0.2)                                  -
-#> 84           aotus (0.1), dmrt1 (0.1)                                  -
-#> 85             aotus (0.1), app (0.1)                                  -
-#> 86           aff22 (0.1), aotus (0.1)                                  -
-#> 87            aotus (0.1), bst2 (0.1)                                  -
-#> 88         aotus (0.2), genomic (0.2)                                  -
-#> 89         aotus (0.2), genomic (0.2)                                  -
-#> 90         aotus (0.2), genomic (0.2)                                  -
-#> 91         aotus (0.2), genomic (0.2)                                  -
-#> 92         aotus (0.2), genomic (0.2)                                  -
-#> 93         aotus (0.2), genomic (0.2)                                  -
-#> 94             aotus (0.1), cds (0.1)                       ifngamma (1)
-#> 95             cd4 (0.2), aotus (0.1)                                  -
-#> 96         gene (0.1), sequence (0.1)         16s (0.3), ribosomal (0.3)
-#> 97            aotus (0.1), mrna (0.1)          aotusb2m (0.8), b2m (0.2)
-#> 98          aotus (0.09), gene (0.09)         sinealu (0.4), color (0.2)
-#> 99           aotus (0.1), beta (0.08)      loc105722736 (0.7), cgb (0.3)
-#> 100         autos (0.1), azarai (0.1)                                  -
-#>  [ reached getOption("max.print") -- omitted 93 rows ]
    # the above generates a data.frame with information on each cluster:
-# ID - unique id in the object
-# Type - cluster type
-# Seed - most connected sequence
-# Parent - MRCA of all represented taxa
-# N_taxa - number of NCBI recognised taxa
-# N_seqs - number of sequences
-# Med_sql - median sequence length
-# MAD - Maximum alignment density, values close to 1 indicate all sequences in
-#  the cluster have a similar length.
-# Definition - most common words (and frequency) in sequence definitions
-# Feature - most common feature name (and frequency)
-
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/SeqArc-class.html b/docs/reference/SeqArc-class.html deleted file mode 100644 index b63392b..0000000 --- a/docs/reference/SeqArc-class.html +++ /dev/null @@ -1,2843 +0,0 @@ - - - - - - - - -Sequence record archive — SeqArc-class • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Sequence record archive

    - Source: R/all-classes.R - -
    - -
    - -

    Multiple sequence records containing sequence data.

    - -
    - - 
    # S4 method for SeqArc
-as.character(x)
-
-# S4 method for SeqArc
-show(object)
-
-# S4 method for SeqArc
-print(x)
-
-# S4 method for SeqArc
-str(object, max.level = 2L, ...)
-
-# S4 method for SeqArc
-summary(object)
-
-# S4 method for SeqArc,character
-[[(x, i)
-
-# S4 method for SeqArc,character,missing,missing
-[(x, i, j, ..., drop = TRUE)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    x

    SeqArc object

    object

    SeqArc object

    max.level

    Maximum level of nesting for str()

    ...

    Further arguments for str()

    i

    sid(s)

    j

    Unused

    drop

    Unused

    - -

    Details

    - -

    Sequences are stored as raw. Use rawToChar().

    - -

    Slots

    - - -
    -
    ids

    Vector of Sequence Record IDs

    -
    nncltds

    Vector of sequence lengths

    -
    nambgs

    Vector of number of ambiguous nucleotides

    -
    txids

    Vector source txid associated with each sequence

    -
    sqs

    List of SeqRecs named by ID

    -
    - -

    See also

    - -

    Other run-public: ClstrArc-class, - ClstrRec-class, - Phylota-class, SeqRec-class, - TaxDict-class, TaxRec-class, - clusters2_run, clusters_run, - parameters_reset, reset, - restart, run, - setup, taxise_run

    - - -

    Examples

    - 
    data('aotus')
-seqarc <- aotus@sqs
-# this is a SeqArc object
-# it contains sequence records
-show(seqarc)
    #> Archive of sequence record(s)
-#>  - [1499] sequences
-#>  - [13] unique txids
-#>  - [548] median sequence length
-#>  - [0] median ambiguous nucleotides
    # you can access its different data slots with @
-seqarc@ids     # sequence IDs defined as accession + feature position
    #>    [1] "FJ623078.1"            "U38998.1"              "U88361.1"             
-#>    [4] "AY684995.1"            "AY684994.1"            "AY684993.1"           
-#>    [7] "AY684992.1/1..1422"    "AY684991.1/1..975"     "U88362.1"             
-#>   [10] "U88363.1"              "U88364.1"              "AY227074.1"           
-#>   [13] "AY227073.1"            "AY227072.1"            "AY227071.1"           
-#>   [16] "AY227070.1"            "AY227069.1"            "AY227068.1"           
-#>   [19] "AY227067.1"            "AY227066.1"            "AY227065.1"           
-#>   [22] "AY227064.1"            "AY227063.1"            "AY227062.1"           
-#>   [25] "AY227061.1"            "AY227060.1"            "AY227059.1"           
-#>   [28] "AY227058.1"            "AY227057.1"            "AY227056.1"           
-#>   [31] "AY227055.1"            "AY114513.1"            "AF201297.1/23..790"   
-#>   [34] "AF201296.1/23..790"    "AF201295.1/23..790"    "AF201294.1/23..790"   
-#>   [37] "AF201293.1/23..790"    "AF042146.1/11..370"    "AF042146.1/371..877"  
-#>   [40] "AF042144.1/11..370"    "AF042144.1/371..877"   "GQ280000.1"           
-#>   [43] "GQ279969.1"            "GQ279950.1"            "GQ279948.1"           
-#>   [46] "GQ279925.1"            "GQ279913.1"            "GQ279878.1"           
-#>   [49] "GQ279859.1"            "GQ279822.1"            "GQ279802.1"           
-#>   [52] "GQ279784.1"            "AY646198.1/152..1576"  "AF420045.1/255..1619" 
-#>   [55] "DM461196.1"            "DM461195.1"            "DM461194.1"           
-#>   [58] "DM461193.1"            "DM461192.1"            "DM461191.1"           
-#>   [61] "DM367551.1"            "DM367548.1"            "DM367545.1"           
-#>   [64] "DM367544.1"            "DM367543.1"            "DM367542.1"           
-#>   [67] "DM367541.1"            "DM367540.1"            "DM371283.1"           
-#>   [70] "DM371280.1"            "DM371276.1"            "DM371275.1"           
-#>   [73] "DM371274.1"            "DM371273.1"            "DM371272.1"           
-#>   [76] "DM371271.1"            "AB439577.1"            "DQ200808.1"           
-#>   [79] "DQ334827.1"            "AY449080.1"            "AY449079.1"           
-#>   [82] "AY449071.1"            "AY449070.1"            "AY449069.1"           
-#>   [85] "AY449065.1"            "AY449059.1"            "AY449058.1"           
-#>   [88] "AY449057.1"            "AY449013.1"            "AY449012.1"           
-#>   [91] "AY449011.1"            "AY449010.1"            "AY449009.1"           
-#>   [94] "AY455163.1"            "AY900569.1"            "AY900568.1"           
-#>   [97] "AY900563.1"            "AY900551.1"            "AY900525.1"           
-#>  [100] "AY947712.1/543..825"   "AB084909.2"            "AB084908.2"           
-#>  [103] "AB084907.2"            "AB081286.2"            "AB081285.2"           
-#>  [106] "AB081284.2"            "AB081283.2"            "AB081282.2"           
-#>  [109] "AB081281.2"            "AB081280.2"            "AB081279.2"           
-#>  [112] "AB081278.2"            "AB181216.1"            "AB181215.1"           
-#>  [115] "AB181214.1/283..580"   "AB181213.1"            "AB181212.1"           
-#>  [118] "AB181211.1/463..760"   "AB181210.1"            "AB181209.1"           
-#>  [121] "AB181208.1/452..749"   "AB181207.1"            "AY225806.1"           
-#>  [124] "AY225805.1"            "AY225802.1"            "AY225801.1"           
-#>  [127] "AY225800.1"            "AY225797.1"            "AJ489745.1"           
-#>  [130] "AJ489746.1"            "AB107211.1"            "AY246458.1"           
-#>  [133] "AF489256.1/1..298"     "AF489244.1/762..1058"  "AY055463.1"           
-#>  [136] "AF286383.1"            "U52114.1"              "AB023939.1"           
-#>  [139] "AB023938.1"            "AB023937.1"            "HM756917.1"           
-#>  [142] "HM756916.1"            "HM756841.1"            "HM756840.1"           
-#>  [145] "HM756839.1"            "HM756838.1"            "HM757001.1"           
-#>  [148] "HM757000.1"            "HM756999.1"            "HM757384.1"           
-#>  [151] "HM757383.1"            "HM757382.1"            "HM757381.1"           
-#>  [154] "HM757380.1"            "HM757379.1"            "HM757559.1"           
-#>  [157] "HM757558.1"            "HM757557.1"            "HM757556.1"           
-#>  [160] "HM757555.1"            "HM757554.1"            "HM757725.1"           
-#>  [163] "HM757724.1"            "HM757723.1"            "HM757722.1"           
-#>  [166] "HM757721.1"            "HM757720.1"            "HM757999.1"           
-#>  [169] "HM758217.1"            "HM758216.1"            "HM758215.1"           
-#>  [172] "HM758214.1"            "HM758213.1"            "HM758212.1"           
-#>  [175] "HM758450.1"            "HM758304.1"            "HM758303.1"           
-#>  [178] "HM758302.1"            "HM758297.1"            "HM758295.1"           
-#>  [181] "HM758476.1"            "HM758475.1"            "HM758466.1"           
-#>  [184] "HM758465.1"            "HM758464.1"            "HM758463.1"           
-#>  [187] "HM758660.1"            "HM758659.1"            "HM758658.1"           
-#>  [190] "HM758657.1"            "HM758656.1"            "HM758655.1"           
-#>  [193] "HM758650.1"            "HM758648.1"            "HM758935.1"           
-#>  [196] "HM758934.1"            "HM758933.1"            "HM758932.1"           
-#>  [199] "HM758931.1"            "HM758930.1"            "HM759106.1"           
-#>  [202] "HM759105.1"            "HM759104.1"            "HM759103.1"           
-#>  [205] "HM759102.1"            "HM759101.1"            "HM759279.1"           
-#>  [208] "HM759278.1"            "HM759277.1"            "HM759276.1"           
-#>  [211] "HM759275.1"            "HM759274.1"            "HM759273.1"           
-#>  [214] "HM759535.1"            "HM759379.1"            "HM759378.1"           
-#>  [217] "HM759377.1"            "HM759372.1"            "HM759370.1"           
-#>  [220] "HM759647.1"            "HM759646.1"            "HM759645.1"           
-#>  [223] "HM759644.1"            "HM759643.1"            "HM759641.1"           
-#>  [226] "HM759836.1"            "HM759819.1"            "HM759777.1"           
-#>  [229] "HM759775.1"            "HM759730.1"            "HM759729.1"           
-#>  [232] "HM760059.1"            "HM759903.1"            "HM759902.1"           
-#>  [235] "HM759901.1"            "HM759896.1"            "HM759894.1"           
-#>  [238] "HM760239.1"            "HM760087.1"            "HM760086.1"           
-#>  [241] "HM760085.1"            "HM760080.1"            "HM760078.1"           
-#>  [244] "HM760421.1"            "HM760263.1"            "HM760262.1"           
-#>  [247] "HM760261.1"            "HM760256.1"            "HM760254.1"           
-#>  [250] "HM760530.1"            "HM760529.1"            "HM760528.1"           
-#>  [253] "HM760527.1"            "HM760526.1"            "HM760525.1"           
-#>  [256] "HM760759.1"            "HM760615.1"            "HM760614.1"           
-#>  [259] "HM760613.1"            "HM760608.1"            "HM760606.1"           
-#>  [262] "HM760776.1"            "HM760775.1"            "HM760774.1"           
-#>  [265] "HM761014.1"            "HM761013.1"            "HM761012.1"           
-#>  [268] "HM761011.1"            "HM761146.1"            "HM761145.1"           
-#>  [271] "HM761144.1"            "HM761143.1"            "HM761207.1"           
-#>  [274] "HM761206.1"            "HM761196.1"            "HM761195.1"           
-#>  [277] "HM761194.1"            "HM761193.1"            "HM761664.1"           
-#>  [280] "HM761514.1"            "HM761513.1"            "HM761512.1"           
-#>  [283] "HM761507.1"            "HM761505.1"            "HM761773.1"           
-#>  [286] "HM761772.1"            "HM761771.1"            "HM761770.1"           
-#>  [289] "HM761769.1"            "HM761768.1"            "HM761930.1"           
-#>  [292] "HM761929.1"            "HM761928.1"            "HM761927.1"           
-#>  [295] "HM761926.1"            "HM761925.1"            "HM762097.1"           
-#>  [298] "HM762096.1"            "HM762095.1"            "HM762094.1"           
-#>  [301] "HM762093.1"            "HM762092.1"            "HM762324.1"           
-#>  [304] "HM762245.1"            "HM762207.1"            "HM762199.1"           
-#>  [307] "HM762181.1"            "HM762180.1"            "HM762432.1"           
-#>  [310] "HM762431.1"            "HM762430.1"            "HM762429.1"           
-#>  [313] "HM762428.1"            "HM762427.1"            "HM762674.1"           
-#>  [316] "HM762517.1"            "HM762516.1"            "HM762511.1"           
-#>  [319] "HM762509.1"            "HM762770.1"            "HM762769.1"           
-#>  [322] "HM762768.1"            "HM762767.1"            "HM762766.1"           
-#>  [325] "HM762765.1"            "HM762863.1"            "HM762862.1"           
-#>  [328] "HM762858.1"            "HM762856.1"            "HM763022.1"           
-#>  [331] "HM763021.1"            "HM763020.1"            "HM763019.1"           
-#>  [334] "HM763266.1"            "HM763265.1"            "HM763264.1"           
-#>  [337] "HM763263.1"            "HM763262.1"            "HM763261.1"           
-#>  [340] "HM763434.1"            "HM763433.1"            "HM763432.1"           
-#>  [343] "HM763431.1"            "HM763430.1"            "HM763429.1"           
-#>  [346] "HM763505.1"            "HM763504.1"            "HM763503.1"           
-#>  [349] "HM763727.1"            "HM763726.1"            "HM763725.1"           
-#>  [352] "HM763724.1"            "HM763723.1"            "HM763722.1"           
-#>  [355] "HM763846.1"            "HM763845.1"            "HM763844.1"           
-#>  [358] "HM763997.1"            "HM763996.1"            "HM763995.1"           
-#>  [361] "HM763994.1"            "HM764215.1"            "HM764188.1"           
-#>  [364] "HM764187.1"            "HM764105.1"            "HM764104.1"           
-#>  [367] "HM764102.1"            "HM764322.1"            "HM764321.1"           
-#>  [370] "HM764320.1"            "HM764319.1"            "HM764318.1"           
-#>  [373] "HM764317.1"            "HM764402.1"            "HM764401.1"           
-#>  [376] "HM764396.1"            "HM764394.1"            "HM764649.1"           
-#>  [379] "HM764648.1"            "HM764647.1"            "HM764646.1"           
-#>  [382] "HM764645.1"            "HM764817.1"            "HM764816.1"           
-#>  [385] "HM764815.1"            "HM764814.1"            "HM764813.1"           
-#>  [388] "HM765068.1"            "HM764910.1"            "HM764909.1"           
-#>  [391] "HM764908.1"            "HM764903.1"            "HM764901.1"           
-#>  [394] "HM765180.1"            "HM765179.1"            "HM765178.1"           
-#>  [397] "HM765177.1"            "HM765176.1"            "HM765175.1"           
-#>  [400] "AB181223.1/324..589"   "AB181222.1/324..589"   "AB181222.1/1555..1849"
-#>  [403] "AB181217.1/324..590"   "AB181217.1/1545..1839" "FJ638418.1"           
-#>  [406] "FJ638417.1"            "FJ638416.1"            "FJ638415.1"           
-#>  [409] "FJ638414.1"            "JQ932362.1"            "JQ932359.1"           
-#>  [412] "JQ932356.1"            "JQ932319.1"            "JQ932318.1"           
-#>  [415] "JQ932310.1"            "JQ932304.1"            "JQ932303.1"           
-#>  [418] "JQ932293.1"            "JQ932280.1"            "JQ932259.1"           
-#>  [421] "JQ932255.1"            "JQ932245.1"            "JQ932232.1"           
-#>  [424] "DQ098868.1"            "DQ098867.1"            "AY455164.1"           
-#>  [427] "AY455162.1"            "AY455159.1"            "AY455158.1"           
-#>  [430] "AY455153.1"            "AF169487.1"            "AF169486.1"           
-#>  [433] "AF169485.1"            "AF042145.1/1..355"     "AF042145.1/356..862"  
-#>  [436] "U59646.1"              "U59645.1"              "U59644.1"             
-#>  [439] "U36845.1"              "U36844.1"              "U36843.1"             
-#>  [442] "U36846.1"              "U36770.1"              "JF444279.1"           
-#>  [445] "JN161098.1"            "JN161097.1"            "JN161096.1"           
-#>  [448] "JN161095.1"            "JN161094.1"            "JN161093.1"           
-#>  [451] "JN161092.1"            "JN161091.1"            "JN161090.1"           
-#>  [454] "JN161089.1"            "JN161088.1"            "JN161087.1"           
-#>  [457] "JN161086.1"            "JN161085.1"            "JN161084.1"           
-#>  [460] "JN161083.1"            "JN161082.1"            "JN161081.1"           
-#>  [463] "JN161080.1"            "JN161079.1"            "JN161078.1"           
-#>  [466] "JN161077.1"            "JN161076.1"            "JN161075.1"           
-#>  [469] "JN161074.1"            "JN161073.1"            "JN161072.1"           
-#>  [472] "JN161071.1"            "JN161070.1"            "JN161069.1"           
-#>  [475] "JQ932775.1"            "JQ932756.1"            "JQ932751.1"           
-#>  [478] "JQ932724.1"            "JQ932717.1"            "JQ932662.1"           
-#>  [481] "JQ932636.1"            "JQ932630.1"            "JQ932605.1"           
-#>  [484] "JQ932597.1"            "JQ932590.1"            "JQ933099.1"           
-#>  [487] "JQ933082.1"            "JQ933076.1"            "JQ933075.1"           
-#>  [490] "JQ933053.1"            "JQ933029.1"            "JQ933028.1"           
-#>  [493] "JQ933027.1"            "JQ933026.1"            "JQ933023.1"           
-#>  [496] "JQ933020.1"            "JQ933011.1"            "JQ933006.1"           
-#>  [499] "JQ933005.1"            "JQ933004.1"            "JQ933001.1"           
-#>  [502] "JQ933000.1"            "JQ932999.1"            "JQ932998.1"           
-#>  [505] "JQ932997.1"            "JQ932996.1"            "JQ932995.1"           
-#>  [508] "JQ932994.1"            "JQ932993.1"            "JQ932992.1"           
-#>  [511] "JQ932991.1"            "JQ932990.1"            "JQ932989.1"           
-#>  [514] "JQ932988.1"            "JQ932987.1"            "JQ932986.1"           
-#>  [517] "JQ932985.1"            "JQ932984.1"            "JQ932983.1"           
-#>  [520] "JQ932982.1"            "JQ932981.1"            "JQ932980.1"           
-#>  [523] "JQ932979.1"            "JQ932978.1"            "JQ932977.1"           
-#>  [526] "JQ932976.1"            "JQ932975.1"            "JQ932974.1"           
-#>  [529] "JQ932973.1"            "JQ932972.1"            "JQ932971.1"           
-#>  [532] "JQ932970.1"            "JQ932969.1"            "JQ932967.1"           
-#>  [535] "JQ932966.1"            "JQ932965.1"            "JQ932964.1"           
-#>  [538] "JQ932963.1"            "JQ932962.1"            "JQ932961.1"           
-#>  [541] "JQ932960.1"            "JQ932959.1"            "JQ932958.1"           
-#>  [544] "JQ932957.1"            "JQ932956.1"            "JQ932955.1"           
-#>  [547] "JQ932954.1"            "JQ932953.1"            "JQ932934.1"           
-#>  [550] "JQ932933.1"            "JQ932932.1"            "JQ932931.1"           
-#>  [553] "JQ932930.1"            "JQ932929.1"            "JQ932928.1"           
-#>  [556] "JQ932927.1"            "JQ932926.1"            "JQ932925.1"           
-#>  [559] "JQ932924.1"            "JQ932923.1"            "JQ932922.1"           
-#>  [562] "JQ932921.1"            "JQ932920.1"            "JQ932918.1"           
-#>  [565] "JQ932916.1"            "JQ932914.1"            "JQ932913.1"           
-#>  [568] "JQ932909.1"            "JQ932908.1"            "JQ932905.1"           
-#>  [571] "JQ932903.1"            "JQ932897.1"            "JQ932896.1"           
-#>  [574] "JQ932895.1"            "JQ932892.1"            "JQ932891.1"           
-#>  [577] "JQ932890.1"            "JQ932889.1"            "JQ932888.1"           
-#>  [580] "JQ932887.1"            "JQ932886.1"            "JQ932885.1"           
-#>  [583] "JQ932884.1"            "JQ932882.1"            "JQ932881.1"           
-#>  [586] "JQ932880.1"            "JQ932879.1"            "JQ932877.1"           
-#>  [589] "JQ932874.1"            "JQ932873.1"            "JQ932872.1"           
-#>  [592] "JQ932870.1"            "JQ932869.1"            "JQ932868.1"           
-#>  [595] "JQ932867.1"            "JQ932866.1"            "JQ932865.1"           
-#>  [598] "JQ932864.1"            "JQ932863.1"            "JQ932862.1"           
-#>  [601] "JQ932861.1"            "JQ932859.1"            "JQ932857.1"           
-#>  [604] "JQ932856.1"            "JQ932855.1"            "JQ932854.1"           
-#>  [607] "JQ932853.1"            "JQ932852.1"            "JQ932851.1"           
-#>  [610] "JQ932850.1"            "JQ932849.1"            "JQ932847.1"           
-#>  [613] "JQ932846.1"            "JQ932845.1"            "JQ932844.1"           
-#>  [616] "JQ932843.1"            "JQ932842.1"            "JQ932841.1"           
-#>  [619] "JQ932840.1"            "JQ932839.1"            "JQ932838.1"           
-#>  [622] "JQ932837.1"            "JQ932836.1"            "JQ932835.1"           
-#>  [625] "JQ932833.1"            "JQ932831.1"            "JQ932830.1"           
-#>  [628] "JQ932829.1"            "JQ932827.1"            "JQ932823.1"           
-#>  [631] "JQ932822.1"            "JQ932821.1"            "JQ932818.1"           
-#>  [634] "JQ932817.1"            "JQ932816.1"            "JQ932815.1"           
-#>  [637] "JQ932814.1"            "JQ932813.1"            "JQ932812.1"           
-#>  [640] "JQ932809.1"            "JQ932807.1"            "JQ932806.1"           
-#>  [643] "JQ932805.1"            "JQ932804.1"            "JQ932803.1"           
-#>  [646] "JQ932802.1"            "JQ932801.1"            "JQ932800.1"           
-#>  [649] "JQ932799.1"            "JQ932794.1"            "KC760418.1"           
-#>  [652] "KC760417.1"            "KC760388.1"            "KC760387.1"           
-#>  [655] "KC760386.1"            "KC760385.1"            "KC760329.1"           
-#>  [658] "KC760328.1"            "KC760327.1"            "KC760326.1"           
-#>  [661] "KC760297.1"            "KC760296.1"            "KC760295.1"           
-#>  [664] "KC760266.1"            "KC760265.1"            "KC760264.1"           
-#>  [667] "KC760263.1"            "KC760231.1"            "KC760230.1"           
-#>  [670] "KC760229.1"            "KC760228.1"            "AB762011.1"           
-#>  [673] "AB762010.1"            "AB762009.1"            "AB762008.1"           
-#>  [676] "AB762007.1"            "AB762006.1"            "AB762005.1"           
-#>  [679] "AB762004.1"            "AB762003.1"            "AB762002.1"           
-#>  [682] "AB762001.1"            "AB762000.1"            "AB761999.1"           
-#>  [685] "AB761998.1"            "AB761997.1"            "AB761996.1"           
-#>  [688] "AB761995.1"            "AB761994.1"            "AB761993.1"           
-#>  [691] "AB761992.1"            "AB761991.1"            "AB761990.1"           
-#>  [694] "AB761989.1"            "AB761988.1"            "AB761987.1"           
-#>  [697] "AB761986.1"            "HW478260.1"            "HW478259.1"           
-#>  [700] "HW478258.1"            "HW478257.1"            "HW478256.1"           
-#>  [703] "HW478255.1"            "KF014088.1"            "KF014089.1"           
-#>  [706] "KF014091.1/1..1059"    "KF014090.1/1..1059"    "KF014094.1"           
-#>  [709] "KF014093.1"            "KF014092.1"            "KF014098.1/1..1017"   
-#>  [712] "KF014097.1/1..1122"    "KF014096.1/1..1209"    "KF014095.1/1..1104"   
-#>  [715] "KF014103.1"            "KF014102.1"            "KF014101.1"           
-#>  [718] "KF014100.1"            "KF014099.1/1..1332"    "KF014105.1/1..1113"   
-#>  [721] "KF014104.1"            "KF014106.1/1..1212"    "KF014108.1/1..927"    
-#>  [724] "KF014107.1/1..1014"    "KF014109.1"            "KF014110.1/1..1110"   
-#>  [727] "KF014113.1"            "KF014112.1"            "KF014111.1"           
-#>  [730] "KF014116.1"            "KF014115.1"            "KF014114.1"           
-#>  [733] "KF014117.1/1..1263"    "KF014118.1"            "KF014119.1"           
-#>  [736] "KF014120.1/1..1395"    "KF014122.1/1..978"     "KF014121.1/1..1110"   
-#>  [739] "DI178960.1"            "DI178959.1"            "DI178958.1"           
-#>  [742] "DI178957.1"            "DI178956.1"            "DI178955.1"           
-#>  [745] "DI178127.1"            "DI178124.1"            "DI178120.1"           
-#>  [748] "DI178119.1"            "DI178118.1"            "DI178117.1"           
-#>  [751] "DI178116.1"            "DI178115.1"            "AB239248.1"           
-#>  [754] "AB239247.1"            "AB239246.1"            "AB239228.1"           
-#>  [757] "AB239227.1"            "AB239226.1"            "AB239203.1"           
-#>  [760] "AB239202.1"            "AB239201.1"            "AB239200.1"           
-#>  [763] "JQ963361.1"            "JQ963360.1"            "JQ963351.1"           
-#>  [766] "JQ963350.1"            "JQ963349.1"            "JQ963348.1"           
-#>  [769] "JQ963347.1"            "JQ963346.1"            "JQ933101.1"           
-#>  [772] "AY114530.1"            "AY114529.1"            "AY114528.1"           
-#>  [775] "AY114527.1"            "AY114526.1"            "AY114525.1"           
-#>  [778] "AY114524.1"            "AY114523.1"            "AY114522.1"           
-#>  [781] "AY114521.1"            "AY114520.1"            "AY114519.1"           
-#>  [784] "AY114518.1"            "AY114517.1"            "AY114516.1"           
-#>  [787] "AY114515.1"            "AY114514.1"            "AF486450.1"           
-#>  [790] "AF486449.1"            "AF486448.1"            "AF181085.1"           
-#>  [793] "AF004921.1"            "AF027569.1"            "AF027567.1"           
-#>  [796] "AF027566.1"            "AF027565.1"            "AF027564.1"           
-#>  [799] "AF027563.1"            "AF027562.1"            "AF027561.1/1..298"    
-#>  [802] "AF027560.1"            "AF027559.1"            "AF027554.1/1..256"    
-#>  [805] "AF027553.1"            "AF027552.1"            "AF027551.1"           
-#>  [808] "AF027549.1"            "AF027548.1"            "AF027547.1"           
-#>  [811] "AF027546.1/1..274"     "AF027545.1"            "AF027544.1"           
-#>  [814] "AF027543.1/1..265"     "AF027542.1"            "EF658656.1"           
-#>  [817] "EF658655.1"            "EF658654.1"            "EF658653.1"           
-#>  [820] "EF658652.1"            "DQ989366.1"            "AH006732.3/455..733"  
-#>  [823] "AH006511.2/455..733"   "KR528418.1/1..1140"    "KM206808.1"           
-#>  [826] "KM206805.1"            "KM206804.1"            "KC762196.1"           
-#>  [829] "KC762195.1"            "KC762194.1"            "KC762193.1"           
-#>  [832] "KC762163.1"            "KC762162.1"            "KC762161.1"           
-#>  [835] "KC762160.1"            "KC762129.1"            "KC762128.1"           
-#>  [838] "KC762127.1"            "KC762106.1"            "KC762105.1"           
-#>  [841] "KC762104.1"            "KC762075.1"            "KC762074.1"           
-#>  [844] "KC762073.1"            "KC762072.1"            "KC762017.1"           
-#>  [847] "KC762016.1"            "KC762015.1"            "KC762014.1"           
-#>  [850] "KC761983.1"            "KC761982.1"            "KC761981.1"           
-#>  [853] "KC761980.1"            "KC761954.1"            "KC761953.1"           
-#>  [856] "KC761952.1"            "KC761951.1"            "KC761921.1"           
-#>  [859] "KC761920.1"            "KC761919.1"            "KC761918.1"           
-#>  [862] "KC761892.1"            "KC761891.1"            "KC761890.1"           
-#>  [865] "KC761889.1"            "KC761836.1"            "KC761835.1"           
-#>  [868] "KC761834.1"            "KC761833.1"            "KC761816.1"           
-#>  [871] "KC761815.1"            "KC761814.1"            "KC761813.1"           
-#>  [874] "KC761785.1"            "KC761784.1"            "KC761783.1"           
-#>  [877] "KC761782.1"            "KC761757.1"            "KC761756.1"           
-#>  [880] "KC761755.1"            "KC761698.1"            "KC761697.1"           
-#>  [883] "KC761696.1"            "KC761695.1"            "KC761635.1"           
-#>  [886] "KC761634.1"            "KC761633.1"            "KC761632.1"           
-#>  [889] "KC761604.1"            "KC761603.1"            "KC761602.1"           
-#>  [892] "KC761601.1"            "KC761572.1"            "KC761571.1"           
-#>  [895] "KC761570.1"            "KC761569.1"            "KC761540.1"           
-#>  [898] "KC761539.1"            "KC761538.1"            "KC761537.1"           
-#>  [901] "KC761507.1"            "KC761506.1"            "KC761505.1"           
-#>  [904] "KC761504.1"            "KC761473.1"            "KC761472.1"           
-#>  [907] "KC761471.1"            "KC761470.1"            "KC761440.1"           
-#>  [910] "KC761439.1"            "KC761438.1"            "KC761408.1"           
-#>  [913] "KC761407.1"            "KC761406.1"            "KC761405.1"           
-#>  [916] "KC761373.1"            "KC761372.1"            "KC761371.1"           
-#>  [919] "KC761340.1"            "KC761339.1"            "KC761338.1"           
-#>  [922] "KC761279.1"            "KC761278.1"            "KC761277.1"           
-#>  [925] "KC761245.1"            "KC761244.1"            "KC761243.1"           
-#>  [928] "KC761242.1"            "KC761212.1"            "KC761211.1"           
-#>  [931] "KC761210.1"            "KC761180.1"            "KC761179.1"           
-#>  [934] "KC761178.1"            "KC761177.1"            "KC761146.1"           
-#>  [937] "KC761145.1"            "KC761144.1"            "KC761112.1"           
-#>  [940] "KC761111.1"            "KC761083.1"            "KC761082.1"           
-#>  [943] "KC761081.1"            "KC761080.1"            "KC761053.1"           
-#>  [946] "KC761052.1"            "KC761051.1"            "KC761050.1"           
-#>  [949] "KC761019.1"            "KC761018.1"            "KC761017.1"           
-#>  [952] "KC761016.1"            "KC760991.1"            "KC760990.1"           
-#>  [955] "KC760989.1"            "KC760988.1"            "KC760957.1"           
-#>  [958] "KC760956.1"            "KC760955.1"            "KC760954.1"           
-#>  [961] "KC760922.1"            "KC760921.1"            "KC760920.1"           
-#>  [964] "KC760894.1"            "KC760893.1"            "KC760892.1"           
-#>  [967] "KC760891.1"            "KC760869.1"            "KC760868.1"           
-#>  [970] "KC760867.1"            "KC760866.1"            "KC760836.1"           
-#>  [973] "KC760835.1"            "KC760834.1"            "KC760833.1"           
-#>  [976] "KC760805.1"            "KC760804.1"            "KC760803.1"           
-#>  [979] "KC760802.1"            "KC760772.1"            "KC760771.1"           
-#>  [982] "KC760770.1"            "KC760741.1"            "KC760740.1"           
-#>  [985] "KC760739.1"            "KC760738.1"            "KC760715.1"           
-#>  [988] "KC760714.1"            "KC760713.1"            "KC760712.1"           
-#>  [991] "KC760684.1"            "KC760683.1"            "KC760682.1"           
-#>  [994] "KC760681.1"            "KC760649.1"            "KC760648.1"           
-#>  [997] "KC760647.1"            "KC760646.1"            "KC760614.1"           
-#> [1000] "KC760613.1"           
-#>  [ reached getOption("max.print") -- omitted 499 entries ]
    seqarc@nncltds # number of nucleotides of all sequences  
    #>    [1] 1374  525  465  954 1425 1389 1422  975  465  465  465  256  269  269
-#>   [15]  270  269  269  269  270  269  269  270  271  277  271  277  269  266
-#>   [29]  271  266  269  516  768  768  768  768  768  360  507  360  507  887
-#>   [43]  667  631  656  736  885  894  859  666  876  869 1425 1365  267  267
-#>   [57]  267  267  267  267  324  324  267  267  267  267  267  267  324  324
-#>   [71]  267  267  267  267  267  267  765  495 1028  664  667  685  685  685
-#>   [85]  666  667  667  667  685  667  667  667  667  672  321  327  263  290
-#>   [99]  294  283 1121 1237  822 1121 1238  710 1121 1238  822 1121 1238  710
-#>  [113] 1919 1959  298 1088 1920  298  946 1431  298  946  307  303  264  267
-#>  [127]  274  267 1140 1140 1532  388  298  297  426  300  822  297  297  297
-#>  [141]  532  532  559  555  560  549  851  837  837  612  612  612  604  600
-#>  [155]  612  475  475  475  341  427  475  898  909  909  900  871  811  430
-#>  [169]  342  340  340  338  342  342  634  637  647  645  635  635  588  588
-#>  [183]  605  590  590  603  679  679  680  680  709  684  651  686  500  386
-#>  [197]  504  705  706  507 1077 1077 1077 1075 1077 1077  715  715  715  695
-#>  [211]  681  698  715  611  605  611  613  538  613  328  330  330  277  267
-#>  [225]  318  301  355  355  355  355  353  631  634  578  578  580  578  482
-#>  [239]  490  602  606  585  586  534  538  540  537  538  540  554  557  557
-#>  [253]  530  533  557  645  654  662  658  663  663  689  703  703  764  760
-#>  [267]  759  765  802  802  804  801  606  606  621  617  617  631  547  558
-#>  [281]  573  565  487  490  476  479  479  406  424  475  729  700  731  738
-#>  [295]  695  695  732  732  732  704  707  707  761  761  761  761  731  731
-#>  [309]  985  960  960  926  957  905  474  522  521  522  496  614  592  613
-#>  [323]  586  559  612  629  624  623  624  431  431  422  403 1000 1000 1000
-#>  [337]  983  993 1000  395  403  406  343  364  408  767  773  783  856 1245
-#>  [351] 1239 1248 1246 1245  587  513  514  778  771  771  779  882  991  986
-#>  [365]  998  998  998  951  951  951  735  930  951  530  530  530  530  676
-#>  [379]  674  674  611  613  575  573  572  561  578  486  486  495  495  493
-#>  [393]  463  411  412  412  329  311  413  266  266  295  267  295  576  576
-#>  [407]  576  576  576  878  847  815  815  885  814  849  936  821  844  856
-#>  [421]  838  868  817 1140 1140  673  673  685  685  685  268  268  268  355
-#>  [435]  507 1071 1071 1074  585  602  621  568  646  653 1088 1088 1085 1088
-#>  [449] 1087 1086 1087 1089 1089 1088 1088 1087 1088 1087 1088 1087 1088 1086
-#>  [463] 1087 1085 1085 1086 1087 1089 1089 1089 1088 1088 1088 1088  773  858
-#>  [477]  858  825  753  856  820  851  823  773  733  684  865  873  856  870
-#>  [491]  894  843  896  886  885  894  875  859  883  875  630  654  633  628
-#>  [505]  634  623  635  634  634  652  633  617  652  622  756  812  762  779
-#>  [519]  789  802  767  774  575  769  817  757  758  777  786  548  545  544
-#>  [533]  564  545  543  542  527  544  542  546  541  539  540  497  538  558
-#>  [547]  521  539  584  746  388  719  373  718  729  717  707  722  666  716
-#>  [561]  619  520  425  439  754  652  737  391  464  471  355  414  352  549
-#>  [575]  343  522  382  345  526  572  391  420  494  573  434  550  432  357
-#>  [589]  355  558  475  475  445  558  467  570  608  586  720  565  294  527
-#>  [603]  836  584  588  582  572  578  492  563  344  598  594  476  545  595
-#>  [617]  552  590  582  586  548  541  714  494  320  510  341  470  507  495
-#>  [631]  581  564  374  568  437  648  585  662  639  634  637  369  643  547
-#>  [645]  542  633  539  633  542  538  557  553  420  420  420  420  470  464
-#>  [659]  439  470  266  264  268  441  475  473  476  274  296  299  318  838
-#>  [673]  839  838  837  837  839  840  841  774  527  582  673  715  678  737
-#>  [687]  843  842  843  741  582  771  785  701  794  800  400  267  267  267
-#>  [701]  267  267  267 1281  987 1059 1059 1281 1281 1245 1017 1122 1209 1104
-#>  [715] 1332 1416 1296 1329 1332 1113 1332 1212  927 1014 1332 1110 1332 1281
-#>  [729] 1332 1613 1415 1613 1263 1617 1416 1395  978 1110  267  267  267  267
-#>  [743]  267  267  324  324  267  267  267  267  267  267  616  617  616  614
-#>  [757]  613  614  587  587  586  587  600  600  560  562  769  581  556  429
-#>  [771]  887  534  534  534  534  534  534  534  534  534  534  534  534  534
-#>  [785]  534  534  534  534  473  473  473  696  433  281  293  287  291  293
-#>  [799]  277  290  298  290  285  256  284  296  296  287  287  284  274  284
-#>  [813]  284  265  359  629  629  629  629  629  346  279  279 1140  706  706
-#>  [827]  701  641  600  537  602  679  748  748  749  720  722  565  566  563
-#>  [841]  575  577  574  575  779  669  601  662  664  625  585  616  617  335
-#>  [855]  642  642  642  772  780  770  781  521  520  523  523  661  659  659
-#>  [869]  674  667  667  679  679  656  680  652  701  905  701  950  643  827
-#>  [883]  596  837  645  700  714  717  425  425  425  426  749  740  604  750
-#>  [897]  451  463  463  464  493  759  561  934 1036 1038  614  903  594  595
-#>  [911]  592  462  458  266  461  615  616  614  538  511  547  475  467  451
-#>  [925]  677  680  671  644  257  386  397  704  655  611  729  464  464  462
-#>  [939]  621  621  663  663  663  663  470  474  473  433  410  445  446  445
-#>  [953]  363  362  362  301  442  449  313  449  568  568  568  573  516  571
-#>  [967]  583  475  453  475  475  527  527  527  500  466  465  461  453  668
-#>  [981]  683  644  534  536  518  488  309  314  284  314  816  630  683  893
-#>  [995]  631  677  663  691  502  533
-#>  [ reached getOption("max.print") -- omitted 499 entries ]
    seqarc@nambgs  # number of ambiguous nucleotides of all sequences
    #>    [1]  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0
-#>   [25]  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0 28  0  0  0  0  2  2
-#>   [49]  3  0  2  2  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0
-#>   [73]  0  0  0  0  0  0  0  0  7  0  1  0  3  4  7  0  0 13  0  3  0  0  0  0
-#>   [97]  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0
-#>  [121]  0  0  0  0  0  0  0  0  0  0  0  0  1  0  0  0  0  0  0  0  0  0  0  0
-#>  [145]  0  0  0  0  0  1  0  0  1  0  0  2  0  0  0  0  2  0  4  1  0  0  0  0
-#>  [169]  0  0  0  0  0  0  0  1  0  0  1  0  0  0  0  0  0  0  0  0  0  0  0  0
-#>  [193]  0  0  0  0  0  0  0  2  0  0  0  0  0  0  1  0  0  1  0  0  1  0  0  0
-#>  [217]  0  1  0  0  0  0  1  0  0  2  0  0  0  0  0  1  1  0  0  0  0  0  0  0
-#>  [241]  0  2  1  0  0  0  0  0  0  0  0  0  0  0  1  1  0  0  0  0  0  0  0  0
-#>  [265]  0  1  0  0  0  1  0  1  0  0  1  2  0  0  0  0  0  0  0  0  0  2  0  0
-#>  [289]  0  0  1  1  0  0  0  2  0  4  0  0  0  0  0  0  3  0  1  0  0  0  0  0
-#>  [313]  0  0  0  0  0  1  0  0  0  0  0  0  0  1  0  1  0  0  1  0  0  0  0  0
-#>  [337]  0  0  3  0  0  1  0  0  1  2  0  2  0  1  0  0  0  1  0  0  0  0  0  0
-#>  [361]  0  0  0  0  0  4  2  0  1  0  0  0  0  0  1  0  0  0  2  0  0  0  0  0
-#>  [385]  0  0  0  0  0  0  0  0  0  0  1  0  0  0  0  0  0  0  0  0  0  0  0  0
-#>  [409]  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  2  1  3  0  0  2  1  0  0
-#>  [433]  0  0  0  0  0  0  0 49  0  1  1  0  0  0  3  0  0  0  0  0  2  0  3  0
-#>  [457]  0  0  0  2  0  0  0  2  0  0  0  1  0  0  0  2 12  0  0  0  1  0  0  0
-#>  [481]  0  0  0  0  0 44  3  2  2  5  5  1  1  3  2  2  3  3  4  2  2  1  1  0
-#>  [505]  1  2  2  1  2  1  0  1  0  1  4  6  6  7  5  5  2  4 13  1  8  5  2  6
-#>  [529]  4 10  7  3  2  0  0  0  7  0  6  3  0  2  0  4  0  0  3  2  2  3 14  4
-#>  [553]  7  5  4  9 14  1  6  6  2  8  9 20 24 25 18 21 11  9 22 11 10 14 10 17
-#>  [577]  4  6 14  2 31 13 19 12  9  6 15 20  1 10 15  1 10 10 14  2  6  2  5  4
-#>  [601]  2  5 12  3  3  2 11  4  1 13 12  4  2 14 12  8  6  7  1  2  6  8 20  7
-#>  [625]  3 14 13  4  6  3  7  2  3  3  9  3 12  6  9  6  4  4  9  3  4  9  1  5
-#>  [649]  5  1  1  0  0  0  0  0  0  0  0  0  0  0  0  0  1  0  0  0  0  0  0  0
-#>  [673]  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0
-#>  [697]  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0
-#>  [721]  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0
-#>  [745]  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  4  4  1  2
-#>  [769]  0  4 28  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0 14
-#>  [793]  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  0  2  0  1  0  0  0  0  1
-#>  [817]  1  1  1  1  0  1  0  0  0  0  1  0  2  0  1  0  0  0  0  0  1  1  0  0
-#>  [841]  7  1  0  2  2  1  1  1  0  0  2  2  1  0  1  0  2  0  0  0  0  0  0  0
-#>  [865]  0  2  1  0  1  0  0  0  0  0  1  2  0  8  2 10  1  2  1  0  0  0  0  0
-#>  [889]  3  0  0  0  0  3  0  5  1  0  1  0  4  1  1  0  0  0  0  0  0  0  1  0
-#>  [913]  0  0  0  2  0  0  0  0  0  0  0  0  0  1  1  0  0  1  0  1  0  0  1  0
-#>  [937]  2  0  0  0  0  0  4  1  1  0  0  0  0  0  1  0  0  0  1  0  1  0  0  0
-#>  [961]  0  0  0  0  0  2  0  0  0  0  0  0  0  0  1  0  1  1  0  0  0  0  0  0
-#>  [985]  1  0  0  0  0  0  1  0  0  0  2  1  0  0  0  1
-#>  [ reached getOption("max.print") -- omitted 499 entries ]
    seqarc@txids   # all the taxonomic IDs for all sequences
    #>    [1] "37293"   "9505"    "37293"   "9505"    "9505"    "9505"    "9505"   
-#>    [8] "9505"    "57176"   "57175"   "43147"   "231953"  "231953"  "231953" 
-#>   [15] "231953"  "231953"  "231953"  "231953"  "231953"  "231953"  "231953" 
-#>   [22] "231953"  "231953"  "231953"  "231953"  "231953"  "231953"  "231953" 
-#>   [29] "231953"  "231953"  "231953"  "37293"   "37293"   "37293"   "37293"  
-#>   [36] "37293"   "37293"   "30591"   "30591"   "37293"   "37293"   "43147"  
-#>   [43] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>   [50] "43147"   "43147"   "43147"   "9505"    "30591"   "9505"    "9505"   
-#>   [57] "9505"    "9505"    "9505"    "9505"    "9505"    "9505"    "9505"   
-#>   [64] "9505"    "9505"    "9505"    "9505"    "9505"    "9505"    "9505"   
-#>   [71] "9505"    "9505"    "9505"    "9505"    "9505"    "9505"    "9505"   
-#>   [78] "37293"   "9505"    "30591"   "30591"   "30591"   "30591"   "30591"  
-#>   [85] "30591"   "30591"   "30591"   "30591"   "30591"   "30591"   "30591"  
-#>   [92] "30591"   "30591"   "30591"   "37293"   "37293"   "37293"   "37293"  
-#>   [99] "37293"   "30591"   "280755"  "280755"  "280755"  "280755"  "280755" 
-#>  [106] "280755"  "280755"  "280755"  "280755"  "280755"  "280755"  "280755" 
-#>  [113] "280755"  "280755"  "280755"  "280755"  "280755"  "280755"  "280755" 
-#>  [120] "280755"  "280755"  "280755"  "37293"   "37293"   "37293"   "37293"  
-#>  [127] "37293"   "37293"   "37293"   "37293"   "9505"    "9505"    "30591"  
-#>  [134] "30591"   "9505"    "37293"   "9505"    "9505"    "9505"    "9505"   
-#>  [141] "867331"  "280755"  "9505"    "37293"   "292213"  "30591"   "867331" 
-#>  [148] "280755"  "30591"   "9505"    "37293"   "292213"  "280755"  "867331" 
-#>  [155] "30591"   "9505"    "37293"   "292213"  "280755"  "867331"  "30591"  
-#>  [162] "9505"    "37293"   "292213"  "867331"  "280755"  "30591"   "30591"  
-#>  [169] "9505"    "37293"   "292213"  "867331"  "280755"  "30591"   "867331" 
-#>  [176] "280755"  "30591"   "9505"    "37293"   "292213"  "867331"  "280755" 
-#>  [183] "9505"    "37293"   "292213"  "30591"   "867331"  "867331"  "280755" 
-#>  [190] "280755"  "30591"   "9505"    "37293"   "292213"  "9505"    "37293"  
-#>  [197] "292213"  "867331"  "280755"  "30591"   "9505"    "37293"   "292213" 
-#>  [204] "280755"  "30591"   "867331"  "9505"    "37293"   "292213"  "867331" 
-#>  [211] "280755"  "867331"  "30591"   "867331"  "280755"  "30591"   "9505"   
-#>  [218] "37293"   "292213"  "9505"    "37293"   "292213"  "867331"  "280755" 
-#>  [225] "30591"   "30591"   "9505"    "280755"  "867331"  "292213"  "37293"  
-#>  [232] "867331"  "280755"  "30591"   "9505"    "37293"   "292213"  "867331" 
-#>  [239] "280755"  "30591"   "9505"    "37293"   "292213"  "867331"  "280755" 
-#>  [246] "30591"   "9505"    "37293"   "292213"  "9505"    "37293"   "292213" 
-#>  [253] "280755"  "867331"  "30591"   "867331"  "280755"  "30591"   "9505"   
-#>  [260] "37293"   "292213"  "9505"    "37293"   "292213"  "9505"    "37293"  
-#>  [267] "292213"  "30591"   "9505"    "37293"   "292213"  "30591"   "867331" 
-#>  [274] "280755"  "9505"    "37293"   "292213"  "30591"   "867331"  "280755" 
-#>  [281] "30591"   "9505"    "37293"   "292213"  "9505"    "37293"   "292213" 
-#>  [288] "867331"  "280755"  "30591"   "9505"    "37293"   "292213"  "867331" 
-#>  [295] "280755"  "30591"   "9505"    "37293"   "292213"  "867331"  "280755" 
-#>  [302] "30591"   "30591"   "9505"    "37293"   "292213"  "867331"  "280755" 
-#>  [309] "9505"    "37293"   "292213"  "867331"  "280755"  "30591"   "867331" 
-#>  [316] "30591"   "9505"    "37293"   "292213"  "9505"    "292213"  "37293"  
-#>  [323] "280755"  "867331"  "30591"   "30591"   "9505"    "37293"   "292213" 
-#>  [330] "9505"    "37293"   "292213"  "280755"  "9505"    "37293"   "292213" 
-#>  [337] "867331"  "280755"  "30591"   "9505"    "37293"   "292213"  "867331" 
-#>  [344] "280755"  "30591"   "9505"    "292213"  "30591"   "9505"    "37293"  
-#>  [351] "292213"  "867331"  "280755"  "30591"   "9505"    "37293"   "292213" 
-#>  [358] "9505"    "37293"   "292213"  "30591"   "292213"  "867331"  "280755" 
-#>  [365] "9505"    "37293"   "30591"   "9505"    "37293"   "292213"  "867331" 
-#>  [372] "280755"  "30591"   "30591"   "9505"    "37293"   "292213"  "9505"   
-#>  [379] "37293"   "292213"  "867331"  "30591"   "9505"    "37293"   "292213" 
-#>  [386] "280755"  "30591"   "867331"  "280755"  "30591"   "9505"    "37293"  
-#>  [393] "292213"  "9505"    "37293"   "292213"  "867331"  "280755"  "30591"  
-#>  [400] "292213"  "292213"  "292213"  "280755"  "280755"  "57176"   "57176"  
-#>  [407] "37293"   "37293"   "292213"  "43147"   "43147"   "43147"   "43147"  
-#>  [414] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [421] "43147"   "43147"   "43147"   "867331"  "867331"  "30591"   "30591"  
-#>  [428] "30591"   "30591"   "30591"   "37293"   "37293"   "37293"   "37293"  
-#>  [435] "37293"   "9505"    "9505"    "9505"    "43147"   "43147"   "43147"  
-#>  [442] "30591"   "37293"   "1002694" "120088"  "120088"  "120088"  "120088" 
-#>  [449] "120088"  "120088"  "120088"  "120088"  "120088"  "120088"  "120088" 
-#>  [456] "120088"  "120088"  "120088"  "120088"  "120088"  "120088"  "120088" 
-#>  [463] "120088"  "120088"  "120088"  "120088"  "120088"  "120088"  "120088" 
-#>  [470] "120088"  "120088"  "120088"  "120088"  "120088"  "43147"   "43147"  
-#>  [477] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [484] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [491] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [498] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [505] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [512] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [519] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [526] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [533] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [540] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [547] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [554] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [561] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [568] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [575] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [582] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [589] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [596] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [603] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [610] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [617] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [624] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [631] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [638] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [645] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "37293"  
-#>  [652] "43147"   "57176"   "30591"   "37293"   "43147"   "57176"   "30591"  
-#>  [659] "37293"   "43147"   "57176"   "37293"   "43147"   "57176"   "30591"  
-#>  [666] "37293"   "43147"   "57176"   "30591"   "37293"   "43147"   "30591"  
-#>  [673] "30591"   "30591"   "30591"   "30591"   "30591"   "30591"   "30591"  
-#>  [680] "30591"   "30591"   "30591"   "30591"   "30591"   "30591"   "30591"  
-#>  [687] "30591"   "30591"   "30591"   "30591"   "30591"   "30591"   "30591"  
-#>  [694] "30591"   "30591"   "30591"   "30591"   "9505"    "9505"    "9505"   
-#>  [701] "9505"    "9505"    "9505"    "57176"   "57176"   "57176"   "57176"  
-#>  [708] "57176"   "57176"   "57176"   "57176"   "57176"   "57176"   "57176"  
-#>  [715] "57176"   "57176"   "57176"   "57176"   "57176"   "57176"   "57176"  
-#>  [722] "57176"   "57176"   "57176"   "57176"   "57176"   "57176"   "57176"  
-#>  [729] "57176"   "57176"   "57176"   "57176"   "57176"   "57176"   "57176"  
-#>  [736] "57176"   "57176"   "57176"   "9505"    "9505"    "9505"    "9505"   
-#>  [743] "9505"    "9505"    "9505"    "9505"    "9505"    "9505"    "9505"   
-#>  [750] "9505"    "9505"    "9505"    "9505"    "9505"    "9505"    "9505"   
-#>  [757] "9505"    "9505"    "9505"    "9505"    "9505"    "9505"    "43147"  
-#>  [764] "43147"   "43147"   "43147"   "43147"   "43147"   "43147"   "43147"  
-#>  [771] "43147"   "57176"   "57176"   "57175"   "57175"   "57175"   "57175"  
-#>  [778] "57175"   "57175"   "57175"   "37293"   "37293"   "37293"   "37293"  
-#>  [785] "37293"   "37293"   "37293"   "37293"   "37293"   "37293"   "37293"  
-#>  [792] "120088"  "9505"    "37293"   "37293"   "37293"   "37293"   "37293"  
-#>  [799] "37293"   "37293"   "37293"   "37293"   "37293"   "37293"   "37293"  
-#>  [806] "37293"   "37293"   "37293"   "37293"   "37293"   "37293"   "37293"  
-#>  [813] "37293"   "37293"   "37293"   "30591"   "30591"   "30591"   "30591"  
-#>  [820] "30591"   "867331"  "30591"   "43147"   "231953"  "9505"    "57175"  
-#>  [827] "292213"  "57176"   "30591"   "37293"   "43147"   "57176"   "30591"  
-#>  [834] "37293"   "43147"   "30591"   "37293"   "43147"   "57176"   "30591"  
-#>  [841] "43147"   "57176"   "30591"   "37293"   "43147"   "57176"   "30591"  
-#>  [848] "37293"   "43147"   "57176"   "30591"   "37293"   "43147"   "57176"  
-#>  [855] "30591"   "37293"   "43147"   "57176"   "30591"   "37293"   "43147"  
-#>  [862] "57176"   "30591"   "37293"   "43147"   "57176"   "30591"   "37293"  
-#>  [869] "43147"   "57176"   "30591"   "37293"   "43147"   "57176"   "30591"  
-#>  [876] "37293"   "43147"   "30591"   "37293"   "43147"   "57176"   "30591"  
-#>  [883] "37293"   "43147"   "57176"   "30591"   "37293"   "43147"   "57176"  
-#>  [890] "30591"   "37293"   "43147"   "57176"   "30591"   "37293"   "43147"  
-#>  [897] "57176"   "30591"   "37293"   "43147"   "57176"   "30591"   "37293"  
-#>  [904] "43147"   "57176"   "30591"   "37293"   "43147"   "30591"   "37293"  
-#>  [911] "43147"   "57176"   "30591"   "37293"   "43147"   "57176"   "30591"  
-#>  [918] "43147"   "30591"   "37293"   "43147"   "57176"   "30591"   "37293"  
-#>  [925] "57176"   "30591"   "37293"   "43147"   "57176"   "30591"   "43147"  
-#>  [932] "57176"   "30591"   "37293"   "43147"   "30591"   "37293"   "43147"  
-#>  [939] "30591"   "43147"   "57176"   "30591"   "37293"   "43147"   "57176"  
-#>  [946] "30591"   "37293"   "43147"   "57176"   "30591"   "37293"   "43147"  
-#>  [953] "57176"   "30591"   "37293"   "43147"   "57176"   "30591"   "37293"  
-#>  [960] "43147"   "57176"   "30591"   "37293"   "57176"   "30591"   "37293"  
-#>  [967] "43147"   "57176"   "30591"   "37293"   "43147"   "57176"   "30591"  
-#>  [974] "37293"   "43147"   "57176"   "30591"   "37293"   "43147"   "30591"  
-#>  [981] "37293"   "43147"   "57176"   "30591"   "37293"   "43147"   "57176"  
-#>  [988] "30591"   "37293"   "43147"   "57176"   "30591"   "37293"   "43147"  
-#>  [995] "57176"   "30591"   "37293"   "43147"   "57176"   "30591"  
-#>  [ reached getOption("max.print") -- omitted 499 entries ]
    seqarc@sqs     # list of all SeqRecs
    #> [[1]]
-#> SeqRec [ID: FJ623078.1]
-#> [[2]]
-#> SeqRec [ID: U38998.1]
-#> [[3]]
-#> SeqRec [ID: U88361.1]
-#> [[4]]
-#> SeqRec [ID: AY684995.1]
-#> [[5]]
-#> SeqRec [ID: AY684994.1]
-#> [[6]]
-#> SeqRec [ID: AY684993.1]
-#> [[7]]
-#> SeqRec [ID: AY684992.1/1..1422]
-#> [[8]]
-#> SeqRec [ID: AY684991.1/1..975]
-#> [[9]]
-#> SeqRec [ID: U88362.1]
-#> [[10]]
-#> SeqRec [ID: U88363.1]
-#> [[11]]
-#> SeqRec [ID: U88364.1]
-#> [[12]]
-#> SeqRec [ID: AY227074.1]
-#> [[13]]
-#> SeqRec [ID: AY227073.1]
-#> [[14]]
-#> SeqRec [ID: AY227072.1]
-#> [[15]]
-#> SeqRec [ID: AY227071.1]
-#> [[16]]
-#> SeqRec [ID: AY227070.1]
-#> [[17]]
-#> SeqRec [ID: AY227069.1]
-#> [[18]]
-#> SeqRec [ID: AY227068.1]
-#> [[19]]
-#> SeqRec [ID: AY227067.1]
-#> [[20]]
-#> SeqRec [ID: AY227066.1]
-#> [[21]]
-#> SeqRec [ID: AY227065.1]
-#> [[22]]
-#> SeqRec [ID: AY227064.1]
-#> [[23]]
-#> SeqRec [ID: AY227063.1]
-#> [[24]]
-#> SeqRec [ID: AY227062.1]
-#> [[25]]
-#> SeqRec [ID: AY227061.1]
-#> [[26]]
-#> SeqRec [ID: AY227060.1]
-#> [[27]]
-#> SeqRec [ID: AY227059.1]
-#> [[28]]
-#> SeqRec [ID: AY227058.1]
-#> [[29]]
-#> SeqRec [ID: AY227057.1]
-#> [[30]]
-#> SeqRec [ID: AY227056.1]
-#> [[31]]
-#> SeqRec [ID: AY227055.1]
-#> [[32]]
-#> SeqRec [ID: AY114513.1]
-#> [[33]]
-#> SeqRec [ID: AF201297.1/23..790]
-#> [[34]]
-#> SeqRec [ID: AF201296.1/23..790]
-#> [[35]]
-#> SeqRec [ID: AF201295.1/23..790]
-#> [[36]]
-#> SeqRec [ID: AF201294.1/23..790]
-#> [[37]]
-#> SeqRec [ID: AF201293.1/23..790]
-#> [[38]]
-#> SeqRec [ID: AF042146.1/11..370]
-#> [[39]]
-#> SeqRec [ID: AF042146.1/371..877]
-#> [[40]]
-#> SeqRec [ID: AF042144.1/11..370]
-#> [[41]]
-#> SeqRec [ID: AF042144.1/371..877]
-#> [[42]]
-#> SeqRec [ID: GQ280000.1]
-#> [[43]]
-#> SeqRec [ID: GQ279969.1]
-#> [[44]]
-#> SeqRec [ID: GQ279950.1]
-#> [[45]]
-#> SeqRec [ID: GQ279948.1]
-#> [[46]]
-#> SeqRec [ID: GQ279925.1]
-#> [[47]]
-#> SeqRec [ID: GQ279913.1]
-#> [[48]]
-#> SeqRec [ID: GQ279878.1]
-#> [[49]]
-#> SeqRec [ID: GQ279859.1]
-#> [[50]]
-#> SeqRec [ID: GQ279822.1]
-#> [[51]]
-#> SeqRec [ID: GQ279802.1]
-#> [[52]]
-#> SeqRec [ID: GQ279784.1]
-#> [[53]]
-#> SeqRec [ID: AY646198.1/152..1576]
-#> [[54]]
-#> SeqRec [ID: AF420045.1/255..1619]
-#> [[55]]
-#> SeqRec [ID: DM461196.1]
-#> [[56]]
-#> SeqRec [ID: DM461195.1]
-#> [[57]]
-#> SeqRec [ID: DM461194.1]
-#> [[58]]
-#> SeqRec [ID: DM461193.1]
-#> [[59]]
-#> SeqRec [ID: DM461192.1]
-#> [[60]]
-#> SeqRec [ID: DM461191.1]
-#> [[61]]
-#> SeqRec [ID: DM367551.1]
-#> [[62]]
-#> SeqRec [ID: DM367548.1]
-#> [[63]]
-#> SeqRec [ID: DM367545.1]
-#> [[64]]
-#> SeqRec [ID: DM367544.1]
-#> [[65]]
-#> SeqRec [ID: DM367543.1]
-#> [[66]]
-#> SeqRec [ID: DM367542.1]
-#> [[67]]
-#> SeqRec [ID: DM367541.1]
-#> [[68]]
-#> SeqRec [ID: DM367540.1]
-#> [[69]]
-#> SeqRec [ID: DM371283.1]
-#> [[70]]
-#> SeqRec [ID: DM371280.1]
-#> [[71]]
-#> SeqRec [ID: DM371276.1]
-#> [[72]]
-#> SeqRec [ID: DM371275.1]
-#> [[73]]
-#> SeqRec [ID: DM371274.1]
-#> [[74]]
-#> SeqRec [ID: DM371273.1]
-#> [[75]]
-#> SeqRec [ID: DM371272.1]
-#> [[76]]
-#> SeqRec [ID: DM371271.1]
-#> [[77]]
-#> SeqRec [ID: AB439577.1]
-#> [[78]]
-#> SeqRec [ID: DQ200808.1]
-#> [[79]]
-#> SeqRec [ID: DQ334827.1]
-#> [[80]]
-#> SeqRec [ID: AY449080.1]
-#> [[81]]
-#> SeqRec [ID: AY449079.1]
-#> [[82]]
-#> SeqRec [ID: AY449071.1]
-#> [[83]]
-#> SeqRec [ID: AY449070.1]
-#> [[84]]
-#> SeqRec [ID: AY449069.1]
-#> [[85]]
-#> SeqRec [ID: AY449065.1]
-#> [[86]]
-#> SeqRec [ID: AY449059.1]
-#> [[87]]
-#> SeqRec [ID: AY449058.1]
-#> [[88]]
-#> SeqRec [ID: AY449057.1]
-#> [[89]]
-#> SeqRec [ID: AY449013.1]
-#> [[90]]
-#> SeqRec [ID: AY449012.1]
-#> [[91]]
-#> SeqRec [ID: AY449011.1]
-#> [[92]]
-#> SeqRec [ID: AY449010.1]
-#> [[93]]
-#> SeqRec [ID: AY449009.1]
-#> [[94]]
-#> SeqRec [ID: AY455163.1]
-#> [[95]]
-#> SeqRec [ID: AY900569.1]
-#> [[96]]
-#> SeqRec [ID: AY900568.1]
-#> [[97]]
-#> SeqRec [ID: AY900563.1]
-#> [[98]]
-#> SeqRec [ID: AY900551.1]
-#> [[99]]
-#> SeqRec [ID: AY900525.1]
-#> [[100]]
-#> SeqRec [ID: AY947712.1/543..825]
-#> [[101]]
-#> SeqRec [ID: AB084909.2]
-#> [[102]]
-#> SeqRec [ID: AB084908.2]
-#> [[103]]
-#> SeqRec [ID: AB084907.2]
-#> [[104]]
-#> SeqRec [ID: AB081286.2]
-#> [[105]]
-#> SeqRec [ID: AB081285.2]
-#> [[106]]
-#> SeqRec [ID: AB081284.2]
-#> [[107]]
-#> SeqRec [ID: AB081283.2]
-#> [[108]]
-#> SeqRec [ID: AB081282.2]
-#> [[109]]
-#> SeqRec [ID: AB081281.2]
-#> [[110]]
-#> SeqRec [ID: AB081280.2]
-#> [[111]]
-#> SeqRec [ID: AB081279.2]
-#> [[112]]
-#> SeqRec [ID: AB081278.2]
-#> [[113]]
-#> SeqRec [ID: AB181216.1]
-#> [[114]]
-#> SeqRec [ID: AB181215.1]
-#> [[115]]
-#> SeqRec [ID: AB181214.1/283..580]
-#> [[116]]
-#> SeqRec [ID: AB181213.1]
-#> [[117]]
-#> SeqRec [ID: AB181212.1]
-#> [[118]]
-#> SeqRec [ID: AB181211.1/463..760]
-#> [[119]]
-#> SeqRec [ID: AB181210.1]
-#> [[120]]
-#> SeqRec [ID: AB181209.1]
-#> [[121]]
-#> SeqRec [ID: AB181208.1/452..749]
-#> [[122]]
-#> SeqRec [ID: AB181207.1]
-#> [[123]]
-#> SeqRec [ID: AY225806.1]
-#> [[124]]
-#> SeqRec [ID: AY225805.1]
-#> [[125]]
-#> SeqRec [ID: AY225802.1]
-#> [[126]]
-#> SeqRec [ID: AY225801.1]
-#> [[127]]
-#> SeqRec [ID: AY225800.1]
-#> [[128]]
-#> SeqRec [ID: AY225797.1]
-#> [[129]]
-#> SeqRec [ID: AJ489745.1]
-#> [[130]]
-#> SeqRec [ID: AJ489746.1]
-#> [[131]]
-#> SeqRec [ID: AB107211.1]
-#> [[132]]
-#> SeqRec [ID: AY246458.1]
-#> [[133]]
-#> SeqRec [ID: AF489256.1/1..298]
-#> [[134]]
-#> SeqRec [ID: AF489244.1/762..1058]
-#> [[135]]
-#> SeqRec [ID: AY055463.1]
-#> [[136]]
-#> SeqRec [ID: AF286383.1]
-#> [[137]]
-#> SeqRec [ID: U52114.1]
-#> [[138]]
-#> SeqRec [ID: AB023939.1]
-#> [[139]]
-#> SeqRec [ID: AB023938.1]
-#> [[140]]
-#> SeqRec [ID: AB023937.1]
-#> [[141]]
-#> SeqRec [ID: HM756917.1]
-#> [[142]]
-#> SeqRec [ID: HM756916.1]
-#> [[143]]
-#> SeqRec [ID: HM756841.1]
-#> [[144]]
-#> SeqRec [ID: HM756840.1]
-#> [[145]]
-#> SeqRec [ID: HM756839.1]
-#> [[146]]
-#> SeqRec [ID: HM756838.1]
-#> [[147]]
-#> SeqRec [ID: HM757001.1]
-#> [[148]]
-#> SeqRec [ID: HM757000.1]
-#> [[149]]
-#> SeqRec [ID: HM756999.1]
-#> [[150]]
-#> SeqRec [ID: HM757384.1]
-#> [[151]]
-#> SeqRec [ID: HM757383.1]
-#> [[152]]
-#> SeqRec [ID: HM757382.1]
-#> [[153]]
-#> SeqRec [ID: HM757381.1]
-#> [[154]]
-#> SeqRec [ID: HM757380.1]
-#> [[155]]
-#> SeqRec [ID: HM757379.1]
-#> [[156]]
-#> SeqRec [ID: HM757559.1]
-#> [[157]]
-#> SeqRec [ID: HM757558.1]
-#> [[158]]
-#> SeqRec [ID: HM757557.1]
-#> [[159]]
-#> SeqRec [ID: HM757556.1]
-#> [[160]]
-#> SeqRec [ID: HM757555.1]
-#> [[161]]
-#> SeqRec [ID: HM757554.1]
-#> [[162]]
-#> SeqRec [ID: HM757725.1]
-#> [[163]]
-#> SeqRec [ID: HM757724.1]
-#> [[164]]
-#> SeqRec [ID: HM757723.1]
-#> [[165]]
-#> SeqRec [ID: HM757722.1]
-#> [[166]]
-#> SeqRec [ID: HM757721.1]
-#> [[167]]
-#> SeqRec [ID: HM757720.1]
-#> [[168]]
-#> SeqRec [ID: HM757999.1]
-#> [[169]]
-#> SeqRec [ID: HM758217.1]
-#> [[170]]
-#> SeqRec [ID: HM758216.1]
-#> [[171]]
-#> SeqRec [ID: HM758215.1]
-#> [[172]]
-#> SeqRec [ID: HM758214.1]
-#> [[173]]
-#> SeqRec [ID: HM758213.1]
-#> [[174]]
-#> SeqRec [ID: HM758212.1]
-#> [[175]]
-#> SeqRec [ID: HM758450.1]
-#> [[176]]
-#> SeqRec [ID: HM758304.1]
-#> [[177]]
-#> SeqRec [ID: HM758303.1]
-#> [[178]]
-#> SeqRec [ID: HM758302.1]
-#> [[179]]
-#> SeqRec [ID: HM758297.1]
-#> [[180]]
-#> SeqRec [ID: HM758295.1]
-#> [[181]]
-#> SeqRec [ID: HM758476.1]
-#> [[182]]
-#> SeqRec [ID: HM758475.1]
-#> [[183]]
-#> SeqRec [ID: HM758466.1]
-#> [[184]]
-#> SeqRec [ID: HM758465.1]
-#> [[185]]
-#> SeqRec [ID: HM758464.1]
-#> [[186]]
-#> SeqRec [ID: HM758463.1]
-#> [[187]]
-#> SeqRec [ID: HM758660.1]
-#> [[188]]
-#> SeqRec [ID: HM758659.1]
-#> [[189]]
-#> SeqRec [ID: HM758658.1]
-#> [[190]]
-#> SeqRec [ID: HM758657.1]
-#> [[191]]
-#> SeqRec [ID: HM758656.1]
-#> [[192]]
-#> SeqRec [ID: HM758655.1]
-#> [[193]]
-#> SeqRec [ID: HM758650.1]
-#> [[194]]
-#> SeqRec [ID: HM758648.1]
-#> [[195]]
-#> SeqRec [ID: HM758935.1]
-#> [[196]]
-#> SeqRec [ID: HM758934.1]
-#> [[197]]
-#> SeqRec [ID: HM758933.1]
-#> [[198]]
-#> SeqRec [ID: HM758932.1]
-#> [[199]]
-#> SeqRec [ID: HM758931.1]
-#> [[200]]
-#> SeqRec [ID: HM758930.1]
-#> [[201]]
-#> SeqRec [ID: HM759106.1]
-#> [[202]]
-#> SeqRec [ID: HM759105.1]
-#> [[203]]
-#> SeqRec [ID: HM759104.1]
-#> [[204]]
-#> SeqRec [ID: HM759103.1]
-#> [[205]]
-#> SeqRec [ID: HM759102.1]
-#> [[206]]
-#> SeqRec [ID: HM759101.1]
-#> [[207]]
-#> SeqRec [ID: HM759279.1]
-#> [[208]]
-#> SeqRec [ID: HM759278.1]
-#> [[209]]
-#> SeqRec [ID: HM759277.1]
-#> [[210]]
-#> SeqRec [ID: HM759276.1]
-#> [[211]]
-#> SeqRec [ID: HM759275.1]
-#> [[212]]
-#> SeqRec [ID: HM759274.1]
-#> [[213]]
-#> SeqRec [ID: HM759273.1]
-#> [[214]]
-#> SeqRec [ID: HM759535.1]
-#> [[215]]
-#> SeqRec [ID: HM759379.1]
-#> [[216]]
-#> SeqRec [ID: HM759378.1]
-#> [[217]]
-#> SeqRec [ID: HM759377.1]
-#> [[218]]
-#> SeqRec [ID: HM759372.1]
-#> [[219]]
-#> SeqRec [ID: HM759370.1]
-#> [[220]]
-#> SeqRec [ID: HM759647.1]
-#> [[221]]
-#> SeqRec [ID: HM759646.1]
-#> [[222]]
-#> SeqRec [ID: HM759645.1]
-#> [[223]]
-#> SeqRec [ID: HM759644.1]
-#> [[224]]
-#> SeqRec [ID: HM759643.1]
-#> [[225]]
-#> SeqRec [ID: HM759641.1]
-#> [[226]]
-#> SeqRec [ID: HM759836.1]
-#> [[227]]
-#> SeqRec [ID: HM759819.1]
-#> [[228]]
-#> SeqRec [ID: HM759777.1]
-#> [[229]]
-#> SeqRec [ID: HM759775.1]
-#> [[230]]
-#> SeqRec [ID: HM759730.1]
-#> [[231]]
-#> SeqRec [ID: HM759729.1]
-#> [[232]]
-#> SeqRec [ID: HM760059.1]
-#> [[233]]
-#> SeqRec [ID: HM759903.1]
-#> [[234]]
-#> SeqRec [ID: HM759902.1]
-#> [[235]]
-#> SeqRec [ID: HM759901.1]
-#> [[236]]
-#> SeqRec [ID: HM759896.1]
-#> [[237]]
-#> SeqRec [ID: HM759894.1]
-#> [[238]]
-#> SeqRec [ID: HM760239.1]
-#> [[239]]
-#> SeqRec [ID: HM760087.1]
-#> [[240]]
-#> SeqRec [ID: HM760086.1]
-#> [[241]]
-#> SeqRec [ID: HM760085.1]
-#> [[242]]
-#> SeqRec [ID: HM760080.1]
-#> [[243]]
-#> SeqRec [ID: HM760078.1]
-#> [[244]]
-#> SeqRec [ID: HM760421.1]
-#> [[245]]
-#> SeqRec [ID: HM760263.1]
-#> [[246]]
-#> SeqRec [ID: HM760262.1]
-#> [[247]]
-#> SeqRec [ID: HM760261.1]
-#> [[248]]
-#> SeqRec [ID: HM760256.1]
-#> [[249]]
-#> SeqRec [ID: HM760254.1]
-#> [[250]]
-#> SeqRec [ID: HM760530.1]
-#> [[251]]
-#> SeqRec [ID: HM760529.1]
-#> [[252]]
-#> SeqRec [ID: HM760528.1]
-#> [[253]]
-#> SeqRec [ID: HM760527.1]
-#> [[254]]
-#> SeqRec [ID: HM760526.1]
-#> [[255]]
-#> SeqRec [ID: HM760525.1]
-#> [[256]]
-#> SeqRec [ID: HM760759.1]
-#> [[257]]
-#> SeqRec [ID: HM760615.1]
-#> [[258]]
-#> SeqRec [ID: HM760614.1]
-#> [[259]]
-#> SeqRec [ID: HM760613.1]
-#> [[260]]
-#> SeqRec [ID: HM760608.1]
-#> [[261]]
-#> SeqRec [ID: HM760606.1]
-#> [[262]]
-#> SeqRec [ID: HM760776.1]
-#> [[263]]
-#> SeqRec [ID: HM760775.1]
-#> [[264]]
-#> SeqRec [ID: HM760774.1]
-#> [[265]]
-#> SeqRec [ID: HM761014.1]
-#> [[266]]
-#> SeqRec [ID: HM761013.1]
-#> [[267]]
-#> SeqRec [ID: HM761012.1]
-#> [[268]]
-#> SeqRec [ID: HM761011.1]
-#> [[269]]
-#> SeqRec [ID: HM761146.1]
-#> [[270]]
-#> SeqRec [ID: HM761145.1]
-#> [[271]]
-#> SeqRec [ID: HM761144.1]
-#> [[272]]
-#> SeqRec [ID: HM761143.1]
-#> [[273]]
-#> SeqRec [ID: HM761207.1]
-#> [[274]]
-#> SeqRec [ID: HM761206.1]
-#> [[275]]
-#> SeqRec [ID: HM761196.1]
-#> [[276]]
-#> SeqRec [ID: HM761195.1]
-#> [[277]]
-#> SeqRec [ID: HM761194.1]
-#> [[278]]
-#> SeqRec [ID: HM761193.1]
-#> [[279]]
-#> SeqRec [ID: HM761664.1]
-#> [[280]]
-#> SeqRec [ID: HM761514.1]
-#> [[281]]
-#> SeqRec [ID: HM761513.1]
-#> [[282]]
-#> SeqRec [ID: HM761512.1]
-#> [[283]]
-#> SeqRec [ID: HM761507.1]
-#> [[284]]
-#> SeqRec [ID: HM761505.1]
-#> [[285]]
-#> SeqRec [ID: HM761773.1]
-#> [[286]]
-#> SeqRec [ID: HM761772.1]
-#> [[287]]
-#> SeqRec [ID: HM761771.1]
-#> [[288]]
-#> SeqRec [ID: HM761770.1]
-#> [[289]]
-#> SeqRec [ID: HM761769.1]
-#> [[290]]
-#> SeqRec [ID: HM761768.1]
-#> [[291]]
-#> SeqRec [ID: HM761930.1]
-#> [[292]]
-#> SeqRec [ID: HM761929.1]
-#> [[293]]
-#> SeqRec [ID: HM761928.1]
-#> [[294]]
-#> SeqRec [ID: HM761927.1]
-#> [[295]]
-#> SeqRec [ID: HM761926.1]
-#> [[296]]
-#> SeqRec [ID: HM761925.1]
-#> [[297]]
-#> SeqRec [ID: HM762097.1]
-#> [[298]]
-#> SeqRec [ID: HM762096.1]
-#> [[299]]
-#> SeqRec [ID: HM762095.1]
-#> [[300]]
-#> SeqRec [ID: HM762094.1]
-#> [[301]]
-#> SeqRec [ID: HM762093.1]
-#> [[302]]
-#> SeqRec [ID: HM762092.1]
-#> [[303]]
-#> SeqRec [ID: HM762324.1]
-#> [[304]]
-#> SeqRec [ID: HM762245.1]
-#> [[305]]
-#> SeqRec [ID: HM762207.1]
-#> [[306]]
-#> SeqRec [ID: HM762199.1]
-#> [[307]]
-#> SeqRec [ID: HM762181.1]
-#> [[308]]
-#> SeqRec [ID: HM762180.1]
-#> [[309]]
-#> SeqRec [ID: HM762432.1]
-#> [[310]]
-#> SeqRec [ID: HM762431.1]
-#> [[311]]
-#> SeqRec [ID: HM762430.1]
-#> [[312]]
-#> SeqRec [ID: HM762429.1]
-#> [[313]]
-#> SeqRec [ID: HM762428.1]
-#> [[314]]
-#> SeqRec [ID: HM762427.1]
-#> [[315]]
-#> SeqRec [ID: HM762674.1]
-#> [[316]]
-#> SeqRec [ID: HM762517.1]
-#> [[317]]
-#> SeqRec [ID: HM762516.1]
-#> [[318]]
-#> SeqRec [ID: HM762511.1]
-#> [[319]]
-#> SeqRec [ID: HM762509.1]
-#> [[320]]
-#> SeqRec [ID: HM762770.1]
-#> [[321]]
-#> SeqRec [ID: HM762769.1]
-#> [[322]]
-#> SeqRec [ID: HM762768.1]
-#> [[323]]
-#> SeqRec [ID: HM762767.1]
-#> [[324]]
-#> SeqRec [ID: HM762766.1]
-#> [[325]]
-#> SeqRec [ID: HM762765.1]
-#> [[326]]
-#> SeqRec [ID: HM762863.1]
-#> [[327]]
-#> SeqRec [ID: HM762862.1]
-#> [[328]]
-#> SeqRec [ID: HM762858.1]
-#> [[329]]
-#> SeqRec [ID: HM762856.1]
-#> [[330]]
-#> SeqRec [ID: HM763022.1]
-#> [[331]]
-#> SeqRec [ID: HM763021.1]
-#> [[332]]
-#> SeqRec [ID: HM763020.1]
-#> [[333]]
-#> SeqRec [ID: HM763019.1]
-#> [[334]]
-#> SeqRec [ID: HM763266.1]
-#> [[335]]
-#> SeqRec [ID: HM763265.1]
-#> [[336]]
-#> SeqRec [ID: HM763264.1]
-#> [[337]]
-#> SeqRec [ID: HM763263.1]
-#> [[338]]
-#> SeqRec [ID: HM763262.1]
-#> [[339]]
-#> SeqRec [ID: HM763261.1]
-#> [[340]]
-#> SeqRec [ID: HM763434.1]
-#> [[341]]
-#> SeqRec [ID: HM763433.1]
-#> [[342]]
-#> SeqRec [ID: HM763432.1]
-#> [[343]]
-#> SeqRec [ID: HM763431.1]
-#> [[344]]
-#> SeqRec [ID: HM763430.1]
-#> [[345]]
-#> SeqRec [ID: HM763429.1]
-#> [[346]]
-#> SeqRec [ID: HM763505.1]
-#> [[347]]
-#> SeqRec [ID: HM763504.1]
-#> [[348]]
-#> SeqRec [ID: HM763503.1]
-#> [[349]]
-#> SeqRec [ID: HM763727.1]
-#> [[350]]
-#> SeqRec [ID: HM763726.1]
-#> [[351]]
-#> SeqRec [ID: HM763725.1]
-#> [[352]]
-#> SeqRec [ID: HM763724.1]
-#> [[353]]
-#> SeqRec [ID: HM763723.1]
-#> [[354]]
-#> SeqRec [ID: HM763722.1]
-#> [[355]]
-#> SeqRec [ID: HM763846.1]
-#> [[356]]
-#> SeqRec [ID: HM763845.1]
-#> [[357]]
-#> SeqRec [ID: HM763844.1]
-#> [[358]]
-#> SeqRec [ID: HM763997.1]
-#> [[359]]
-#> SeqRec [ID: HM763996.1]
-#> [[360]]
-#> SeqRec [ID: HM763995.1]
-#> [[361]]
-#> SeqRec [ID: HM763994.1]
-#> [[362]]
-#> SeqRec [ID: HM764215.1]
-#> [[363]]
-#> SeqRec [ID: HM764188.1]
-#> [[364]]
-#> SeqRec [ID: HM764187.1]
-#> [[365]]
-#> SeqRec [ID: HM764105.1]
-#> [[366]]
-#> SeqRec [ID: HM764104.1]
-#> [[367]]
-#> SeqRec [ID: HM764102.1]
-#> [[368]]
-#> SeqRec [ID: HM764322.1]
-#> [[369]]
-#> SeqRec [ID: HM764321.1]
-#> [[370]]
-#> SeqRec [ID: HM764320.1]
-#> [[371]]
-#> SeqRec [ID: HM764319.1]
-#> [[372]]
-#> SeqRec [ID: HM764318.1]
-#> [[373]]
-#> SeqRec [ID: HM764317.1]
-#> [[374]]
-#> SeqRec [ID: HM764402.1]
-#> [[375]]
-#> SeqRec [ID: HM764401.1]
-#> [[376]]
-#> SeqRec [ID: HM764396.1]
-#> [[377]]
-#> SeqRec [ID: HM764394.1]
-#> [[378]]
-#> SeqRec [ID: HM764649.1]
-#> [[379]]
-#> SeqRec [ID: HM764648.1]
-#> [[380]]
-#> SeqRec [ID: HM764647.1]
-#> [[381]]
-#> SeqRec [ID: HM764646.1]
-#> [[382]]
-#> SeqRec [ID: HM764645.1]
-#> [[383]]
-#> SeqRec [ID: HM764817.1]
-#> [[384]]
-#> SeqRec [ID: HM764816.1]
-#> [[385]]
-#> SeqRec [ID: HM764815.1]
-#> [[386]]
-#> SeqRec [ID: HM764814.1]
-#> [[387]]
-#> SeqRec [ID: HM764813.1]
-#> [[388]]
-#> SeqRec [ID: HM765068.1]
-#> [[389]]
-#> SeqRec [ID: HM764910.1]
-#> [[390]]
-#> SeqRec [ID: HM764909.1]
-#> [[391]]
-#> SeqRec [ID: HM764908.1]
-#> [[392]]
-#> SeqRec [ID: HM764903.1]
-#> [[393]]
-#> SeqRec [ID: HM764901.1]
-#> [[394]]
-#> SeqRec [ID: HM765180.1]
-#> [[395]]
-#> SeqRec [ID: HM765179.1]
-#> [[396]]
-#> SeqRec [ID: HM765178.1]
-#> [[397]]
-#> SeqRec [ID: HM765177.1]
-#> [[398]]
-#> SeqRec [ID: HM765176.1]
-#> [[399]]
-#> SeqRec [ID: HM765175.1]
-#> [[400]]
-#> SeqRec [ID: AB181223.1/324..589]
-#> [[401]]
-#> SeqRec [ID: AB181222.1/324..589]
-#> [[402]]
-#> SeqRec [ID: AB181222.1/1555..1849]
-#> [[403]]
-#> SeqRec [ID: AB181217.1/324..590]
-#> [[404]]
-#> SeqRec [ID: AB181217.1/1545..1839]
-#> [[405]]
-#> SeqRec [ID: FJ638418.1]
-#> [[406]]
-#> SeqRec [ID: FJ638417.1]
-#> [[407]]
-#> SeqRec [ID: FJ638416.1]
-#> [[408]]
-#> SeqRec [ID: FJ638415.1]
-#> [[409]]
-#> SeqRec [ID: FJ638414.1]
-#> [[410]]
-#> SeqRec [ID: JQ932362.1]
-#> [[411]]
-#> SeqRec [ID: JQ932359.1]
-#> [[412]]
-#> SeqRec [ID: JQ932356.1]
-#> [[413]]
-#> SeqRec [ID: JQ932319.1]
-#> [[414]]
-#> SeqRec [ID: JQ932318.1]
-#> [[415]]
-#> SeqRec [ID: JQ932310.1]
-#> [[416]]
-#> SeqRec [ID: JQ932304.1]
-#> [[417]]
-#> SeqRec [ID: JQ932303.1]
-#> [[418]]
-#> SeqRec [ID: JQ932293.1]
-#> [[419]]
-#> SeqRec [ID: JQ932280.1]
-#> [[420]]
-#> SeqRec [ID: JQ932259.1]
-#> [[421]]
-#> SeqRec [ID: JQ932255.1]
-#> [[422]]
-#> SeqRec [ID: JQ932245.1]
-#> [[423]]
-#> SeqRec [ID: JQ932232.1]
-#> [[424]]
-#> SeqRec [ID: DQ098868.1]
-#> [[425]]
-#> SeqRec [ID: DQ098867.1]
-#> [[426]]
-#> SeqRec [ID: AY455164.1]
-#> [[427]]
-#> SeqRec [ID: AY455162.1]
-#> [[428]]
-#> SeqRec [ID: AY455159.1]
-#> [[429]]
-#> SeqRec [ID: AY455158.1]
-#> [[430]]
-#> SeqRec [ID: AY455153.1]
-#> [[431]]
-#> SeqRec [ID: AF169487.1]
-#> [[432]]
-#> SeqRec [ID: AF169486.1]
-#> [[433]]
-#> SeqRec [ID: AF169485.1]
-#> [[434]]
-#> SeqRec [ID: AF042145.1/1..355]
-#> [[435]]
-#> SeqRec [ID: AF042145.1/356..862]
-#> [[436]]
-#> SeqRec [ID: U59646.1]
-#> [[437]]
-#> SeqRec [ID: U59645.1]
-#> [[438]]
-#> SeqRec [ID: U59644.1]
-#> [[439]]
-#> SeqRec [ID: U36845.1]
-#> [[440]]
-#> SeqRec [ID: U36844.1]
-#> [[441]]
-#> SeqRec [ID: U36843.1]
-#> [[442]]
-#> SeqRec [ID: U36846.1]
-#> [[443]]
-#> SeqRec [ID: U36770.1]
-#> [[444]]
-#> SeqRec [ID: JF444279.1]
-#> [[445]]
-#> SeqRec [ID: JN161098.1]
-#> [[446]]
-#> SeqRec [ID: JN161097.1]
-#> [[447]]
-#> SeqRec [ID: JN161096.1]
-#> [[448]]
-#> SeqRec [ID: JN161095.1]
-#> [[449]]
-#> SeqRec [ID: JN161094.1]
-#> [[450]]
-#> SeqRec [ID: JN161093.1]
-#> [[451]]
-#> SeqRec [ID: JN161092.1]
-#> [[452]]
-#> SeqRec [ID: JN161091.1]
-#> [[453]]
-#> SeqRec [ID: JN161090.1]
-#> [[454]]
-#> SeqRec [ID: JN161089.1]
-#> [[455]]
-#> SeqRec [ID: JN161088.1]
-#> [[456]]
-#> SeqRec [ID: JN161087.1]
-#> [[457]]
-#> SeqRec [ID: JN161086.1]
-#> [[458]]
-#> SeqRec [ID: JN161085.1]
-#> [[459]]
-#> SeqRec [ID: JN161084.1]
-#> [[460]]
-#> SeqRec [ID: JN161083.1]
-#> [[461]]
-#> SeqRec [ID: JN161082.1]
-#> [[462]]
-#> SeqRec [ID: JN161081.1]
-#> [[463]]
-#> SeqRec [ID: JN161080.1]
-#> [[464]]
-#> SeqRec [ID: JN161079.1]
-#> [[465]]
-#> SeqRec [ID: JN161078.1]
-#> [[466]]
-#> SeqRec [ID: JN161077.1]
-#> [[467]]
-#> SeqRec [ID: JN161076.1]
-#> [[468]]
-#> SeqRec [ID: JN161075.1]
-#> [[469]]
-#> SeqRec [ID: JN161074.1]
-#> [[470]]
-#> SeqRec [ID: JN161073.1]
-#> [[471]]
-#> SeqRec [ID: JN161072.1]
-#> [[472]]
-#> SeqRec [ID: JN161071.1]
-#> [[473]]
-#> SeqRec [ID: JN161070.1]
-#> [[474]]
-#> SeqRec [ID: JN161069.1]
-#> [[475]]
-#> SeqRec [ID: JQ932775.1]
-#> [[476]]
-#> SeqRec [ID: JQ932756.1]
-#> [[477]]
-#> SeqRec [ID: JQ932751.1]
-#> [[478]]
-#> SeqRec [ID: JQ932724.1]
-#> [[479]]
-#> SeqRec [ID: JQ932717.1]
-#> [[480]]
-#> SeqRec [ID: JQ932662.1]
-#> [[481]]
-#> SeqRec [ID: JQ932636.1]
-#> [[482]]
-#> SeqRec [ID: JQ932630.1]
-#> [[483]]
-#> SeqRec [ID: JQ932605.1]
-#> [[484]]
-#> SeqRec [ID: JQ932597.1]
-#> [[485]]
-#> SeqRec [ID: JQ932590.1]
-#> [[486]]
-#> SeqRec [ID: JQ933099.1]
-#> [[487]]
-#> SeqRec [ID: JQ933082.1]
-#> [[488]]
-#> SeqRec [ID: JQ933076.1]
-#> [[489]]
-#> SeqRec [ID: JQ933075.1]
-#> [[490]]
-#> SeqRec [ID: JQ933053.1]
-#> [[491]]
-#> SeqRec [ID: JQ933029.1]
-#> [[492]]
-#> SeqRec [ID: JQ933028.1]
-#> [[493]]
-#> SeqRec [ID: JQ933027.1]
-#> [[494]]
-#> SeqRec [ID: JQ933026.1]
-#> [[495]]
-#> SeqRec [ID: JQ933023.1]
-#> [[496]]
-#> SeqRec [ID: JQ933020.1]
-#> [[497]]
-#> SeqRec [ID: JQ933011.1]
-#> [[498]]
-#> SeqRec [ID: JQ933006.1]
-#> [[499]]
-#> SeqRec [ID: JQ933005.1]
-#> [[500]]
-#> SeqRec [ID: JQ933004.1]
-#> [[501]]
-#> SeqRec [ID: JQ933001.1]
-#> [[502]]
-#> SeqRec [ID: JQ933000.1]
-#> [[503]]
-#> SeqRec [ID: JQ932999.1]
-#> [[504]]
-#> SeqRec [ID: JQ932998.1]
-#> [[505]]
-#> SeqRec [ID: JQ932997.1]
-#> [[506]]
-#> SeqRec [ID: JQ932996.1]
-#> [[507]]
-#> SeqRec [ID: JQ932995.1]
-#> [[508]]
-#> SeqRec [ID: JQ932994.1]
-#> [[509]]
-#> SeqRec [ID: JQ932993.1]
-#> [[510]]
-#> SeqRec [ID: JQ932992.1]
-#> [[511]]
-#> SeqRec [ID: JQ932991.1]
-#> [[512]]
-#> SeqRec [ID: JQ932990.1]
-#> [[513]]
-#> SeqRec [ID: JQ932989.1]
-#> [[514]]
-#> SeqRec [ID: JQ932988.1]
-#> [[515]]
-#> SeqRec [ID: JQ932987.1]
-#> [[516]]
-#> SeqRec [ID: JQ932986.1]
-#> [[517]]
-#> SeqRec [ID: JQ932985.1]
-#> [[518]]
-#> SeqRec [ID: JQ932984.1]
-#> [[519]]
-#> SeqRec [ID: JQ932983.1]
-#> [[520]]
-#> SeqRec [ID: JQ932982.1]
-#> [[521]]
-#> SeqRec [ID: JQ932981.1]
-#> [[522]]
-#> SeqRec [ID: JQ932980.1]
-#> [[523]]
-#> SeqRec [ID: JQ932979.1]
-#> [[524]]
-#> SeqRec [ID: JQ932978.1]
-#> [[525]]
-#> SeqRec [ID: JQ932977.1]
-#> [[526]]
-#> SeqRec [ID: JQ932976.1]
-#> [[527]]
-#> SeqRec [ID: JQ932975.1]
-#> [[528]]
-#> SeqRec [ID: JQ932974.1]
-#> [[529]]
-#> SeqRec [ID: JQ932973.1]
-#> [[530]]
-#> SeqRec [ID: JQ932972.1]
-#> [[531]]
-#> SeqRec [ID: JQ932971.1]
-#> [[532]]
-#> SeqRec [ID: JQ932970.1]
-#> [[533]]
-#> SeqRec [ID: JQ932969.1]
-#> [[534]]
-#> SeqRec [ID: JQ932967.1]
-#> [[535]]
-#> SeqRec [ID: JQ932966.1]
-#> [[536]]
-#> SeqRec [ID: JQ932965.1]
-#> [[537]]
-#> SeqRec [ID: JQ932964.1]
-#> [[538]]
-#> SeqRec [ID: JQ932963.1]
-#> [[539]]
-#> SeqRec [ID: JQ932962.1]
-#> [[540]]
-#> SeqRec [ID: JQ932961.1]
-#> [[541]]
-#> SeqRec [ID: JQ932960.1]
-#> [[542]]
-#> SeqRec [ID: JQ932959.1]
-#> [[543]]
-#> SeqRec [ID: JQ932958.1]
-#> [[544]]
-#> SeqRec [ID: JQ932957.1]
-#> [[545]]
-#> SeqRec [ID: JQ932956.1]
-#> [[546]]
-#> SeqRec [ID: JQ932955.1]
-#> [[547]]
-#> SeqRec [ID: JQ932954.1]
-#> [[548]]
-#> SeqRec [ID: JQ932953.1]
-#> [[549]]
-#> SeqRec [ID: JQ932934.1]
-#> [[550]]
-#> SeqRec [ID: JQ932933.1]
-#> [[551]]
-#> SeqRec [ID: JQ932932.1]
-#> [[552]]
-#> SeqRec [ID: JQ932931.1]
-#> [[553]]
-#> SeqRec [ID: JQ932930.1]
-#> [[554]]
-#> SeqRec [ID: JQ932929.1]
-#> [[555]]
-#> SeqRec [ID: JQ932928.1]
-#> [[556]]
-#> SeqRec [ID: JQ932927.1]
-#> [[557]]
-#> SeqRec [ID: JQ932926.1]
-#> [[558]]
-#> SeqRec [ID: JQ932925.1]
-#> [[559]]
-#> SeqRec [ID: JQ932924.1]
-#> [[560]]
-#> SeqRec [ID: JQ932923.1]
-#> [[561]]
-#> SeqRec [ID: JQ932922.1]
-#> [[562]]
-#> SeqRec [ID: JQ932921.1]
-#> [[563]]
-#> SeqRec [ID: JQ932920.1]
-#> [[564]]
-#> SeqRec [ID: JQ932918.1]
-#> [[565]]
-#> SeqRec [ID: JQ932916.1]
-#> [[566]]
-#> SeqRec [ID: JQ932914.1]
-#> [[567]]
-#> SeqRec [ID: JQ932913.1]
-#> [[568]]
-#> SeqRec [ID: JQ932909.1]
-#> [[569]]
-#> SeqRec [ID: JQ932908.1]
-#> [[570]]
-#> SeqRec [ID: JQ932905.1]
-#> [[571]]
-#> SeqRec [ID: JQ932903.1]
-#> [[572]]
-#> SeqRec [ID: JQ932897.1]
-#> [[573]]
-#> SeqRec [ID: JQ932896.1]
-#> [[574]]
-#> SeqRec [ID: JQ932895.1]
-#> [[575]]
-#> SeqRec [ID: JQ932892.1]
-#> [[576]]
-#> SeqRec [ID: JQ932891.1]
-#> [[577]]
-#> SeqRec [ID: JQ932890.1]
-#> [[578]]
-#> SeqRec [ID: JQ932889.1]
-#> [[579]]
-#> SeqRec [ID: JQ932888.1]
-#> [[580]]
-#> SeqRec [ID: JQ932887.1]
-#> [[581]]
-#> SeqRec [ID: JQ932886.1]
-#> [[582]]
-#> SeqRec [ID: JQ932885.1]
-#> [[583]]
-#> SeqRec [ID: JQ932884.1]
-#> [[584]]
-#> SeqRec [ID: JQ932882.1]
-#> [[585]]
-#> SeqRec [ID: JQ932881.1]
-#> [[586]]
-#> SeqRec [ID: JQ932880.1]
-#> [[587]]
-#> SeqRec [ID: JQ932879.1]
-#> [[588]]
-#> SeqRec [ID: JQ932877.1]
-#> [[589]]
-#> SeqRec [ID: JQ932874.1]
-#> [[590]]
-#> SeqRec [ID: JQ932873.1]
-#> [[591]]
-#> SeqRec [ID: JQ932872.1]
-#> [[592]]
-#> SeqRec [ID: JQ932870.1]
-#> [[593]]
-#> SeqRec [ID: JQ932869.1]
-#> [[594]]
-#> SeqRec [ID: JQ932868.1]
-#> [[595]]
-#> SeqRec [ID: JQ932867.1]
-#> [[596]]
-#> SeqRec [ID: JQ932866.1]
-#> [[597]]
-#> SeqRec [ID: JQ932865.1]
-#> [[598]]
-#> SeqRec [ID: JQ932864.1]
-#> [[599]]
-#> SeqRec [ID: JQ932863.1]
-#> [[600]]
-#> SeqRec [ID: JQ932862.1]
-#> [[601]]
-#> SeqRec [ID: JQ932861.1]
-#> [[602]]
-#> SeqRec [ID: JQ932859.1]
-#> [[603]]
-#> SeqRec [ID: JQ932857.1]
-#> [[604]]
-#> SeqRec [ID: JQ932856.1]
-#> [[605]]
-#> SeqRec [ID: JQ932855.1]
-#> [[606]]
-#> SeqRec [ID: JQ932854.1]
-#> [[607]]
-#> SeqRec [ID: JQ932853.1]
-#> [[608]]
-#> SeqRec [ID: JQ932852.1]
-#> [[609]]
-#> SeqRec [ID: JQ932851.1]
-#> [[610]]
-#> SeqRec [ID: JQ932850.1]
-#> [[611]]
-#> SeqRec [ID: JQ932849.1]
-#> [[612]]
-#> SeqRec [ID: JQ932847.1]
-#> [[613]]
-#> SeqRec [ID: JQ932846.1]
-#> [[614]]
-#> SeqRec [ID: JQ932845.1]
-#> [[615]]
-#> SeqRec [ID: JQ932844.1]
-#> [[616]]
-#> SeqRec [ID: JQ932843.1]
-#> [[617]]
-#> SeqRec [ID: JQ932842.1]
-#> [[618]]
-#> SeqRec [ID: JQ932841.1]
-#> [[619]]
-#> SeqRec [ID: JQ932840.1]
-#> [[620]]
-#> SeqRec [ID: JQ932839.1]
-#> [[621]]
-#> SeqRec [ID: JQ932838.1]
-#> [[622]]
-#> SeqRec [ID: JQ932837.1]
-#> [[623]]
-#> SeqRec [ID: JQ932836.1]
-#> [[624]]
-#> SeqRec [ID: JQ932835.1]
-#> [[625]]
-#> SeqRec [ID: JQ932833.1]
-#> [[626]]
-#> SeqRec [ID: JQ932831.1]
-#> [[627]]
-#> SeqRec [ID: JQ932830.1]
-#> [[628]]
-#> SeqRec [ID: JQ932829.1]
-#> [[629]]
-#> SeqRec [ID: JQ932827.1]
-#> [[630]]
-#> SeqRec [ID: JQ932823.1]
-#> [[631]]
-#> SeqRec [ID: JQ932822.1]
-#> [[632]]
-#> SeqRec [ID: JQ932821.1]
-#> [[633]]
-#> SeqRec [ID: JQ932818.1]
-#> [[634]]
-#> SeqRec [ID: JQ932817.1]
-#> [[635]]
-#> SeqRec [ID: JQ932816.1]
-#> [[636]]
-#> SeqRec [ID: JQ932815.1]
-#> [[637]]
-#> SeqRec [ID: JQ932814.1]
-#> [[638]]
-#> SeqRec [ID: JQ932813.1]
-#> [[639]]
-#> SeqRec [ID: JQ932812.1]
-#> [[640]]
-#> SeqRec [ID: JQ932809.1]
-#> [[641]]
-#> SeqRec [ID: JQ932807.1]
-#> [[642]]
-#> SeqRec [ID: JQ932806.1]
-#> [[643]]
-#> SeqRec [ID: JQ932805.1]
-#> [[644]]
-#> SeqRec [ID: JQ932804.1]
-#> [[645]]
-#> SeqRec [ID: JQ932803.1]
-#> [[646]]
-#> SeqRec [ID: JQ932802.1]
-#> [[647]]
-#> SeqRec [ID: JQ932801.1]
-#> [[648]]
-#> SeqRec [ID: JQ932800.1]
-#> [[649]]
-#> SeqRec [ID: JQ932799.1]
-#> [[650]]
-#> SeqRec [ID: JQ932794.1]
-#> [[651]]
-#> SeqRec [ID: KC760418.1]
-#> [[652]]
-#> SeqRec [ID: KC760417.1]
-#> [[653]]
-#> SeqRec [ID: KC760388.1]
-#> [[654]]
-#> SeqRec [ID: KC760387.1]
-#> [[655]]
-#> SeqRec [ID: KC760386.1]
-#> [[656]]
-#> SeqRec [ID: KC760385.1]
-#> [[657]]
-#> SeqRec [ID: KC760329.1]
-#> [[658]]
-#> SeqRec [ID: KC760328.1]
-#> [[659]]
-#> SeqRec [ID: KC760327.1]
-#> [[660]]
-#> SeqRec [ID: KC760326.1]
-#> [[661]]
-#> SeqRec [ID: KC760297.1]
-#> [[662]]
-#> SeqRec [ID: KC760296.1]
-#> [[663]]
-#> SeqRec [ID: KC760295.1]
-#> [[664]]
-#> SeqRec [ID: KC760266.1]
-#> [[665]]
-#> SeqRec [ID: KC760265.1]
-#> [[666]]
-#> SeqRec [ID: KC760264.1]
-#> [[667]]
-#> SeqRec [ID: KC760263.1]
-#> [[668]]
-#> SeqRec [ID: KC760231.1]
-#> [[669]]
-#> SeqRec [ID: KC760230.1]
-#> [[670]]
-#> SeqRec [ID: KC760229.1]
-#> [[671]]
-#> SeqRec [ID: KC760228.1]
-#> [[672]]
-#> SeqRec [ID: AB762011.1]
-#> [[673]]
-#> SeqRec [ID: AB762010.1]
-#> [[674]]
-#> SeqRec [ID: AB762009.1]
-#> [[675]]
-#> SeqRec [ID: AB762008.1]
-#> [[676]]
-#> SeqRec [ID: AB762007.1]
-#> [[677]]
-#> SeqRec [ID: AB762006.1]
-#> [[678]]
-#> SeqRec [ID: AB762005.1]
-#> [[679]]
-#> SeqRec [ID: AB762004.1]
-#> [[680]]
-#> SeqRec [ID: AB762003.1]
-#> [[681]]
-#> SeqRec [ID: AB762002.1]
-#> [[682]]
-#> SeqRec [ID: AB762001.1]
-#> [[683]]
-#> SeqRec [ID: AB762000.1]
-#> [[684]]
-#> SeqRec [ID: AB761999.1]
-#> [[685]]
-#> SeqRec [ID: AB761998.1]
-#> [[686]]
-#> SeqRec [ID: AB761997.1]
-#> [[687]]
-#> SeqRec [ID: AB761996.1]
-#> [[688]]
-#> SeqRec [ID: AB761995.1]
-#> [[689]]
-#> SeqRec [ID: AB761994.1]
-#> [[690]]
-#> SeqRec [ID: AB761993.1]
-#> [[691]]
-#> SeqRec [ID: AB761992.1]
-#> [[692]]
-#> SeqRec [ID: AB761991.1]
-#> [[693]]
-#> SeqRec [ID: AB761990.1]
-#> [[694]]
-#> SeqRec [ID: AB761989.1]
-#> [[695]]
-#> SeqRec [ID: AB761988.1]
-#> [[696]]
-#> SeqRec [ID: AB761987.1]
-#> [[697]]
-#> SeqRec [ID: AB761986.1]
-#> [[698]]
-#> SeqRec [ID: HW478260.1]
-#> [[699]]
-#> SeqRec [ID: HW478259.1]
-#> [[700]]
-#> SeqRec [ID: HW478258.1]
-#> [[701]]
-#> SeqRec [ID: HW478257.1]
-#> [[702]]
-#> SeqRec [ID: HW478256.1]
-#> [[703]]
-#> SeqRec [ID: HW478255.1]
-#> [[704]]
-#> SeqRec [ID: KF014088.1]
-#> [[705]]
-#> SeqRec [ID: KF014089.1]
-#> [[706]]
-#> SeqRec [ID: KF014091.1/1..1059]
-#> [[707]]
-#> SeqRec [ID: KF014090.1/1..1059]
-#> [[708]]
-#> SeqRec [ID: KF014094.1]
-#> [[709]]
-#> SeqRec [ID: KF014093.1]
-#> [[710]]
-#> SeqRec [ID: KF014092.1]
-#> [[711]]
-#> SeqRec [ID: KF014098.1/1..1017]
-#> [[712]]
-#> SeqRec [ID: KF014097.1/1..1122]
-#> [[713]]
-#> SeqRec [ID: KF014096.1/1..1209]
-#> [[714]]
-#> SeqRec [ID: KF014095.1/1..1104]
-#> [[715]]
-#> SeqRec [ID: KF014103.1]
-#> [[716]]
-#> SeqRec [ID: KF014102.1]
-#> [[717]]
-#> SeqRec [ID: KF014101.1]
-#> [[718]]
-#> SeqRec [ID: KF014100.1]
-#> [[719]]
-#> SeqRec [ID: KF014099.1/1..1332]
-#> [[720]]
-#> SeqRec [ID: KF014105.1/1..1113]
-#> [[721]]
-#> SeqRec [ID: KF014104.1]
-#> [[722]]
-#> SeqRec [ID: KF014106.1/1..1212]
-#> [[723]]
-#> SeqRec [ID: KF014108.1/1..927]
-#> [[724]]
-#> SeqRec [ID: KF014107.1/1..1014]
-#> [[725]]
-#> SeqRec [ID: KF014109.1]
-#> [[726]]
-#> SeqRec [ID: KF014110.1/1..1110]
-#> [[727]]
-#> SeqRec [ID: KF014113.1]
-#> [[728]]
-#> SeqRec [ID: KF014112.1]
-#> [[729]]
-#> SeqRec [ID: KF014111.1]
-#> [[730]]
-#> SeqRec [ID: KF014116.1]
-#> [[731]]
-#> SeqRec [ID: KF014115.1]
-#> [[732]]
-#> SeqRec [ID: KF014114.1]
-#> [[733]]
-#> SeqRec [ID: KF014117.1/1..1263]
-#> [[734]]
-#> SeqRec [ID: KF014118.1]
-#> [[735]]
-#> SeqRec [ID: KF014119.1]
-#> [[736]]
-#> SeqRec [ID: KF014120.1/1..1395]
-#> [[737]]
-#> SeqRec [ID: KF014122.1/1..978]
-#> [[738]]
-#> SeqRec [ID: KF014121.1/1..1110]
-#> [[739]]
-#> SeqRec [ID: DI178960.1]
-#> [[740]]
-#> SeqRec [ID: DI178959.1]
-#> [[741]]
-#> SeqRec [ID: DI178958.1]
-#> [[742]]
-#> SeqRec [ID: DI178957.1]
-#> [[743]]
-#> SeqRec [ID: DI178956.1]
-#> [[744]]
-#> SeqRec [ID: DI178955.1]
-#> [[745]]
-#> SeqRec [ID: DI178127.1]
-#> [[746]]
-#> SeqRec [ID: DI178124.1]
-#> [[747]]
-#> SeqRec [ID: DI178120.1]
-#> [[748]]
-#> SeqRec [ID: DI178119.1]
-#> [[749]]
-#> SeqRec [ID: DI178118.1]
-#> [[750]]
-#> SeqRec [ID: DI178117.1]
-#> [[751]]
-#> SeqRec [ID: DI178116.1]
-#> [[752]]
-#> SeqRec [ID: DI178115.1]
-#> [[753]]
-#> SeqRec [ID: AB239248.1]
-#> [[754]]
-#> SeqRec [ID: AB239247.1]
-#> [[755]]
-#> SeqRec [ID: AB239246.1]
-#> [[756]]
-#> SeqRec [ID: AB239228.1]
-#> [[757]]
-#> SeqRec [ID: AB239227.1]
-#> [[758]]
-#> SeqRec [ID: AB239226.1]
-#> [[759]]
-#> SeqRec [ID: AB239203.1]
-#> [[760]]
-#> SeqRec [ID: AB239202.1]
-#> [[761]]
-#> SeqRec [ID: AB239201.1]
-#> [[762]]
-#> SeqRec [ID: AB239200.1]
-#> [[763]]
-#> SeqRec [ID: JQ963361.1]
-#> [[764]]
-#> SeqRec [ID: JQ963360.1]
-#> [[765]]
-#> SeqRec [ID: JQ963351.1]
-#> [[766]]
-#> SeqRec [ID: JQ963350.1]
-#> [[767]]
-#> SeqRec [ID: JQ963349.1]
-#> [[768]]
-#> SeqRec [ID: JQ963348.1]
-#> [[769]]
-#> SeqRec [ID: JQ963347.1]
-#> [[770]]
-#> SeqRec [ID: JQ963346.1]
-#> [[771]]
-#> SeqRec [ID: JQ933101.1]
-#> [[772]]
-#> SeqRec [ID: AY114530.1]
-#> [[773]]
-#> SeqRec [ID: AY114529.1]
-#> [[774]]
-#> SeqRec [ID: AY114528.1]
-#> [[775]]
-#> SeqRec [ID: AY114527.1]
-#> [[776]]
-#> SeqRec [ID: AY114526.1]
-#> [[777]]
-#> SeqRec [ID: AY114525.1]
-#> [[778]]
-#> SeqRec [ID: AY114524.1]
-#> [[779]]
-#> SeqRec [ID: AY114523.1]
-#> [[780]]
-#> SeqRec [ID: AY114522.1]
-#> [[781]]
-#> SeqRec [ID: AY114521.1]
-#> [[782]]
-#> SeqRec [ID: AY114520.1]
-#> [[783]]
-#> SeqRec [ID: AY114519.1]
-#> [[784]]
-#> SeqRec [ID: AY114518.1]
-#> [[785]]
-#> SeqRec [ID: AY114517.1]
-#> [[786]]
-#> SeqRec [ID: AY114516.1]
-#> [[787]]
-#> SeqRec [ID: AY114515.1]
-#> [[788]]
-#> SeqRec [ID: AY114514.1]
-#> [[789]]
-#> SeqRec [ID: AF486450.1]
-#> [[790]]
-#> SeqRec [ID: AF486449.1]
-#> [[791]]
-#> SeqRec [ID: AF486448.1]
-#> [[792]]
-#> SeqRec [ID: AF181085.1]
-#> [[793]]
-#> SeqRec [ID: AF004921.1]
-#> [[794]]
-#> SeqRec [ID: AF027569.1]
-#> [[795]]
-#> SeqRec [ID: AF027567.1]
-#> [[796]]
-#> SeqRec [ID: AF027566.1]
-#> [[797]]
-#> SeqRec [ID: AF027565.1]
-#> [[798]]
-#> SeqRec [ID: AF027564.1]
-#> [[799]]
-#> SeqRec [ID: AF027563.1]
-#> [[800]]
-#> SeqRec [ID: AF027562.1]
-#> [[801]]
-#> SeqRec [ID: AF027561.1/1..298]
-#> [[802]]
-#> SeqRec [ID: AF027560.1]
-#> [[803]]
-#> SeqRec [ID: AF027559.1]
-#> [[804]]
-#> SeqRec [ID: AF027554.1/1..256]
-#> [[805]]
-#> SeqRec [ID: AF027553.1]
-#> [[806]]
-#> SeqRec [ID: AF027552.1]
-#> [[807]]
-#> SeqRec [ID: AF027551.1]
-#> [[808]]
-#> SeqRec [ID: AF027549.1]
-#> [[809]]
-#> SeqRec [ID: AF027548.1]
-#> [[810]]
-#> SeqRec [ID: AF027547.1]
-#> [[811]]
-#> SeqRec [ID: AF027546.1/1..274]
-#> [[812]]
-#> SeqRec [ID: AF027545.1]
-#> [[813]]
-#> SeqRec [ID: AF027544.1]
-#> [[814]]
-#> SeqRec [ID: AF027543.1/1..265]
-#> [[815]]
-#> SeqRec [ID: AF027542.1]
-#> [[816]]
-#> SeqRec [ID: EF658656.1]
-#> [[817]]
-#> SeqRec [ID: EF658655.1]
-#> [[818]]
-#> SeqRec [ID: EF658654.1]
-#> [[819]]
-#> SeqRec [ID: EF658653.1]
-#> [[820]]
-#> SeqRec [ID: EF658652.1]
-#> [[821]]
-#> SeqRec [ID: DQ989366.1]
-#> [[822]]
-#> SeqRec [ID: AH006732.3/455..733]
-#> [[823]]
-#> SeqRec [ID: AH006511.2/455..733]
-#> [[824]]
-#> SeqRec [ID: KR528418.1/1..1140]
-#> [[825]]
-#> SeqRec [ID: KM206808.1]
-#> [[826]]
-#> SeqRec [ID: KM206805.1]
-#> [[827]]
-#> SeqRec [ID: KM206804.1]
-#> [[828]]
-#> SeqRec [ID: KC762196.1]
-#> [[829]]
-#> SeqRec [ID: KC762195.1]
-#> [[830]]
-#> SeqRec [ID: KC762194.1]
-#> [[831]]
-#> SeqRec [ID: KC762193.1]
-#> [[832]]
-#> SeqRec [ID: KC762163.1]
-#> [[833]]
-#> SeqRec [ID: KC762162.1]
-#> [[834]]
-#> SeqRec [ID: KC762161.1]
-#> [[835]]
-#> SeqRec [ID: KC762160.1]
-#> [[836]]
-#> SeqRec [ID: KC762129.1]
-#> [[837]]
-#> SeqRec [ID: KC762128.1]
-#> [[838]]
-#> SeqRec [ID: KC762127.1]
-#> [[839]]
-#> SeqRec [ID: KC762106.1]
-#> [[840]]
-#> SeqRec [ID: KC762105.1]
-#> [[841]]
-#> SeqRec [ID: KC762104.1]
-#> [[842]]
-#> SeqRec [ID: KC762075.1]
-#> [[843]]
-#> SeqRec [ID: KC762074.1]
-#> [[844]]
-#> SeqRec [ID: KC762073.1]
-#> [[845]]
-#> SeqRec [ID: KC762072.1]
-#> [[846]]
-#> SeqRec [ID: KC762017.1]
-#> [[847]]
-#> SeqRec [ID: KC762016.1]
-#> [[848]]
-#> SeqRec [ID: KC762015.1]
-#> [[849]]
-#> SeqRec [ID: KC762014.1]
-#> [[850]]
-#> SeqRec [ID: KC761983.1]
-#> [[851]]
-#> SeqRec [ID: KC761982.1]
-#> [[852]]
-#> SeqRec [ID: KC761981.1]
-#> [[853]]
-#> SeqRec [ID: KC761980.1]
-#> [[854]]
-#> SeqRec [ID: KC761954.1]
-#> [[855]]
-#> SeqRec [ID: KC761953.1]
-#> [[856]]
-#> SeqRec [ID: KC761952.1]
-#> [[857]]
-#> SeqRec [ID: KC761951.1]
-#> [[858]]
-#> SeqRec [ID: KC761921.1]
-#> [[859]]
-#> SeqRec [ID: KC761920.1]
-#> [[860]]
-#> SeqRec [ID: KC761919.1]
-#> [[861]]
-#> SeqRec [ID: KC761918.1]
-#> [[862]]
-#> SeqRec [ID: KC761892.1]
-#> [[863]]
-#> SeqRec [ID: KC761891.1]
-#> [[864]]
-#> SeqRec [ID: KC761890.1]
-#> [[865]]
-#> SeqRec [ID: KC761889.1]
-#> [[866]]
-#> SeqRec [ID: KC761836.1]
-#> [[867]]
-#> SeqRec [ID: KC761835.1]
-#> [[868]]
-#> SeqRec [ID: KC761834.1]
-#> [[869]]
-#> SeqRec [ID: KC761833.1]
-#> [[870]]
-#> SeqRec [ID: KC761816.1]
-#> [[871]]
-#> SeqRec [ID: KC761815.1]
-#> [[872]]
-#> SeqRec [ID: KC761814.1]
-#> [[873]]
-#> SeqRec [ID: KC761813.1]
-#> [[874]]
-#> SeqRec [ID: KC761785.1]
-#> [[875]]
-#> SeqRec [ID: KC761784.1]
-#> [[876]]
-#> SeqRec [ID: KC761783.1]
-#> [[877]]
-#> SeqRec [ID: KC761782.1]
-#> [[878]]
-#> SeqRec [ID: KC761757.1]
-#> [[879]]
-#> SeqRec [ID: KC761756.1]
-#> [[880]]
-#> SeqRec [ID: KC761755.1]
-#> [[881]]
-#> SeqRec [ID: KC761698.1]
-#> [[882]]
-#> SeqRec [ID: KC761697.1]
-#> [[883]]
-#> SeqRec [ID: KC761696.1]
-#> [[884]]
-#> SeqRec [ID: KC761695.1]
-#> [[885]]
-#> SeqRec [ID: KC761635.1]
-#> [[886]]
-#> SeqRec [ID: KC761634.1]
-#> [[887]]
-#> SeqRec [ID: KC761633.1]
-#> [[888]]
-#> SeqRec [ID: KC761632.1]
-#> [[889]]
-#> SeqRec [ID: KC761604.1]
-#> [[890]]
-#> SeqRec [ID: KC761603.1]
-#> [[891]]
-#> SeqRec [ID: KC761602.1]
-#> [[892]]
-#> SeqRec [ID: KC761601.1]
-#> [[893]]
-#> SeqRec [ID: KC761572.1]
-#> [[894]]
-#> SeqRec [ID: KC761571.1]
-#> [[895]]
-#> SeqRec [ID: KC761570.1]
-#> [[896]]
-#> SeqRec [ID: KC761569.1]
-#> [[897]]
-#> SeqRec [ID: KC761540.1]
-#> [[898]]
-#> SeqRec [ID: KC761539.1]
-#> [[899]]
-#> SeqRec [ID: KC761538.1]
-#> [[900]]
-#> SeqRec [ID: KC761537.1]
-#> [[901]]
-#> SeqRec [ID: KC761507.1]
-#> [[902]]
-#> SeqRec [ID: KC761506.1]
-#> [[903]]
-#> SeqRec [ID: KC761505.1]
-#> [[904]]
-#> SeqRec [ID: KC761504.1]
-#> [[905]]
-#> SeqRec [ID: KC761473.1]
-#> [[906]]
-#> SeqRec [ID: KC761472.1]
-#> [[907]]
-#> SeqRec [ID: KC761471.1]
-#> [[908]]
-#> SeqRec [ID: KC761470.1]
-#> [[909]]
-#> SeqRec [ID: KC761440.1]
-#> [[910]]
-#> SeqRec [ID: KC761439.1]
-#> [[911]]
-#> SeqRec [ID: KC761438.1]
-#> [[912]]
-#> SeqRec [ID: KC761408.1]
-#> [[913]]
-#> SeqRec [ID: KC761407.1]
-#> [[914]]
-#> SeqRec [ID: KC761406.1]
-#> [[915]]
-#> SeqRec [ID: KC761405.1]
-#> [[916]]
-#> SeqRec [ID: KC761373.1]
-#> [[917]]
-#> SeqRec [ID: KC761372.1]
-#> [[918]]
-#> SeqRec [ID: KC761371.1]
-#> [[919]]
-#> SeqRec [ID: KC761340.1]
-#> [[920]]
-#> SeqRec [ID: KC761339.1]
-#> [[921]]
-#> SeqRec [ID: KC761338.1]
-#> [[922]]
-#> SeqRec [ID: KC761279.1]
-#> [[923]]
-#> SeqRec [ID: KC761278.1]
-#> [[924]]
-#> SeqRec [ID: KC761277.1]
-#> [[925]]
-#> SeqRec [ID: KC761245.1]
-#> [[926]]
-#> SeqRec [ID: KC761244.1]
-#> [[927]]
-#> SeqRec [ID: KC761243.1]
-#> [[928]]
-#> SeqRec [ID: KC761242.1]
-#> [[929]]
-#> SeqRec [ID: KC761212.1]
-#> [[930]]
-#> SeqRec [ID: KC761211.1]
-#> [[931]]
-#> SeqRec [ID: KC761210.1]
-#> [[932]]
-#> SeqRec [ID: KC761180.1]
-#> [[933]]
-#> SeqRec [ID: KC761179.1]
-#> [[934]]
-#> SeqRec [ID: KC761178.1]
-#> [[935]]
-#> SeqRec [ID: KC761177.1]
-#> [[936]]
-#> SeqRec [ID: KC761146.1]
-#> [[937]]
-#> SeqRec [ID: KC761145.1]
-#> [[938]]
-#> SeqRec [ID: KC761144.1]
-#> [[939]]
-#> SeqRec [ID: KC761112.1]
-#> [[940]]
-#> SeqRec [ID: KC761111.1]
-#> [[941]]
-#> SeqRec [ID: KC761083.1]
-#> [[942]]
-#> SeqRec [ID: KC761082.1]
-#> [[943]]
-#> SeqRec [ID: KC761081.1]
-#> [[944]]
-#> SeqRec [ID: KC761080.1]
-#> [[945]]
-#> SeqRec [ID: KC761053.1]
-#> [[946]]
-#> SeqRec [ID: KC761052.1]
-#> [[947]]
-#> SeqRec [ID: KC761051.1]
-#> [[948]]
-#> SeqRec [ID: KC761050.1]
-#> [[949]]
-#> SeqRec [ID: KC761019.1]
-#> [[950]]
-#> SeqRec [ID: KC761018.1]
-#> [[951]]
-#> SeqRec [ID: KC761017.1]
-#> [[952]]
-#> SeqRec [ID: KC761016.1]
-#> [[953]]
-#> SeqRec [ID: KC760991.1]
-#> [[954]]
-#> SeqRec [ID: KC760990.1]
-#> [[955]]
-#> SeqRec [ID: KC760989.1]
-#> [[956]]
-#> SeqRec [ID: KC760988.1]
-#> [[957]]
-#> SeqRec [ID: KC760957.1]
-#> [[958]]
-#> SeqRec [ID: KC760956.1]
-#> [[959]]
-#> SeqRec [ID: KC760955.1]
-#> [[960]]
-#> SeqRec [ID: KC760954.1]
-#> [[961]]
-#> SeqRec [ID: KC760922.1]
-#> [[962]]
-#> SeqRec [ID: KC760921.1]
-#> [[963]]
-#> SeqRec [ID: KC760920.1]
-#> [[964]]
-#> SeqRec [ID: KC760894.1]
-#> [[965]]
-#> SeqRec [ID: KC760893.1]
-#> [[966]]
-#> SeqRec [ID: KC760892.1]
-#> [[967]]
-#> SeqRec [ID: KC760891.1]
-#> [[968]]
-#> SeqRec [ID: KC760869.1]
-#> [[969]]
-#> SeqRec [ID: KC760868.1]
-#> [[970]]
-#> SeqRec [ID: KC760867.1]
-#> [[971]]
-#> SeqRec [ID: KC760866.1]
-#> [[972]]
-#> SeqRec [ID: KC760836.1]
-#> [[973]]
-#> SeqRec [ID: KC760835.1]
-#> [[974]]
-#> SeqRec [ID: KC760834.1]
-#> [[975]]
-#> SeqRec [ID: KC760833.1]
-#> [[976]]
-#> SeqRec [ID: KC760805.1]
-#> [[977]]
-#> SeqRec [ID: KC760804.1]
-#> [[978]]
-#> SeqRec [ID: KC760803.1]
-#> [[979]]
-#> SeqRec [ID: KC760802.1]
-#> [[980]]
-#> SeqRec [ID: KC760772.1]
-#> [[981]]
-#> SeqRec [ID: KC760771.1]
-#> [[982]]
-#> SeqRec [ID: KC760770.1]
-#> [[983]]
-#> SeqRec [ID: KC760741.1]
-#> [[984]]
-#> SeqRec [ID: KC760740.1]
-#> [[985]]
-#> SeqRec [ID: KC760739.1]
-#> [[986]]
-#> SeqRec [ID: KC760738.1]
-#> [[987]]
-#> SeqRec [ID: KC760715.1]
-#> [[988]]
-#> SeqRec [ID: KC760714.1]
-#> [[989]]
-#> SeqRec [ID: KC760713.1]
-#> [[990]]
-#> SeqRec [ID: KC760712.1]
-#> [[991]]
-#> SeqRec [ID: KC760684.1]
-#> [[992]]
-#> SeqRec [ID: KC760683.1]
-#> [[993]]
-#> SeqRec [ID: KC760682.1]
-#> [[994]]
-#> SeqRec [ID: KC760681.1]
-#> [[995]]
-#> SeqRec [ID: KC760649.1]
-#> [[996]]
-#> SeqRec [ID: KC760648.1]
-#> [[997]]
-#> SeqRec [ID: KC760647.1]
-#> [[998]]
-#> SeqRec [ID: KC760646.1]
-#> [[999]]
-#> SeqRec [ID: KC760614.1]
-#> [[1000]]
-#> SeqRec [ID: KC760613.1]
-#>  [ reached getOption("max.print") -- omitted 499 entries ]
    # access sequence records [[
-(seqarc[[seqarc@ids[[1]]]])  # first sequence record
    #> SeqRec [ID: FJ623078.1]
    # generate new sequence archives with [
-(seqarc[seqarc@ids[1:10]])  # first 10 sequences
    #> Archive of sequence record(s)
-#>  - [10] sequences
-#>  - [4] unique txids
-#>  - [964.5] median sequence length
-#>  - [0] median ambiguous nucleotides
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/SeqRec-class.html b/docs/reference/SeqRec-class.html deleted file mode 100644 index 4e5c93b..0000000 --- a/docs/reference/SeqRec-class.html +++ /dev/null @@ -1,278 +0,0 @@ - - - - - - - - -Sequence record — SeqRec-class • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Sequence record

    - Source: R/all-classes.R - -
    - -
    - -

    Sequence record contains sequence data.

    - -
    - - 
    # S4 method for SeqRec
-as.character(x)
-
-# S4 method for SeqRec
-show(object)
-
-# S4 method for SeqRec
-print(x)
-
-# S4 method for SeqRec
-str(object, max.level = 2L, ...)
-
-# S4 method for SeqRec
-summary(object)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - -
    x

    SeqRec object

    object

    SeqRec object

    max.level

    Maximum level of nesting for str()

    ...

    Further arguments for str()

    - -

    Details

    - -

    Sequence is stored as raw. Use rawToChar().

    - -

    Slots

    - - -
    -
    id

    Unique ID

    -
    nm

    Best-guess sequence name

    -
    accssn

    Accession

    -
    vrsn

    Accession version

    -
    url

    URL

    -
    txid

    Taxonomic ID of source taxon

    -
    orgnsm

    Scientific name of source taxon

    -
    sq

    Sequence

    -
    dfln

    Definition line

    -
    ml_typ

    Molecule type, e.g. DNA

    -
    rec_typ

    Record type: Whole or feature

    -
    nncltds

    Number of nucleotides

    -
    nambgs

    Number of ambiguous nucleotides

    -
    pambgs

    Proportion of ambiguous nucleotides

    -
    gcr

    GC ratio

    -
    age

    Number of days between sequence upload and running pipeline

    -
    - -

    See also

    - -

    Other run-public: ClstrArc-class, - ClstrRec-class, - Phylota-class, SeqArc-class, - TaxDict-class, TaxRec-class, - clusters2_run, clusters_run, - parameters_reset, reset, - restart, run, - setup, taxise_run

    - - -

    Examples

    - 
    data('aotus')
-seqrec <- aotus@sqs@sqs[[1]]
-# this is a SeqRec object
-# it contains sequence records
-show(seqrec)
    #> SeqRec [ID: FJ623078.1]
    # you can access its different data slots with @
-seqrec@id       # sequence ID, accession + feature location
    #> [1] "FJ623078.1"
    seqrec@nm       # feature name, '' if none
    #> [1] ""
    seqrec@accssn   # accession
    #> [1] "FJ623078"
    seqrec@vrsn     # accession version
    #> [1] "FJ623078.1"
    seqrec@url      # NCBI GenBank URL
    #> [1] "https://www.ncbi.nlm.nih.gov/nuccore/FJ623078.1"
    seqrec@txid     # Taxonomic ID
    #> [1] "37293"
    seqrec@orgnsm   # free-text organism name
    #> [1] "Aotus nancymaae"
    seqrec@sq       # sequence, in raw format
    #>    [1] 61 74 67 67 61 74 67 67 67 67 67 61 61 74 63 63 63 74 74 74 63 63 67 67
-#>   [25] 63 61 63 74 74 67 63 74 63 63 74 67 67 74 67 63 74 67 63 61 61 63 74 67
-#>   [49] 67 63 67 63 74 61 63 74 63 63 63 61 67 63 61 67 74 63 61 63 74 63 61 63
-#>   [73] 67 67 61 61 61 67 61 63 61 67 74 67 67 74 67 63 74 67 67 67 63 67 61 61
-#>   [97] 61 61 61 67 67 67 67 61 67 61 63 67 67 74 67 67 61 67 63 74 67 63 63 63
-#>  [121] 74 67 74 67 61 61 61 63 74 74 63 63 63 74 67 61 61 67 61 61 67 61 61 63
-#>  [145] 67 74 61 63 61 61 74 74 63 63 61 63 74 67 67 61 61 61 61 63 63 74 63 63
-#>  [169] 67 61 63 63 61 67 61 74 61 61 61 67 61 74 74 63 74 67 67 67 61 61 61 74
-#>  [193] 63 61 67 67 67 63 74 63 63 74 74 63 74 74 67 61 63 74 61 67 61 67 67 74
-#>  [217] 63 61 61 74 63 63 61 61 67 63 74 67 67 63 63 67 61 74 63 67 63 61 74 74
-#>  [241] 67 61 63 74 63 61 61 61 67 61 61 61 61 67 63 74 63 74 74 67 67 67 61 63
-#>  [265] 63 67 61 67 67 61 74 63 63 74 74 74 63 63 63 63 74 67 61 74 63 61 74 63
-#>  [289] 61 61 67 61 61 74 67 74 74 63 61 67 67 74 61 67 61 61 67 61 63 74 63 61
-#>  [313] 67 61 67 61 63 74 74 61 63 61 74 63 74 67 74 67 61 61 67 74 67 67 61 67
-#>  [337] 61 67 61 61 61 67 61 61 67 67 61 67 67 61 67 67 74 67 67 61 61 74 74 67
-#>  [361] 63 61 67 67 74 67 74 74 63 67 67 61 74 74 67 61 63 74 67 63 63 61 67 63
-#>  [385] 63 63 74 67 61 63 61 63 63 63 61 63 63 74 67 63 74 74 63 61 67 67 67 67
-#>  [409] 63 61 67 61 67 63 63 74 67 61 63 63 63 74 67 61 63 63 74 74 67 67 61 67
-#>  [433] 61 67 63 63 63 63 63 63 74 67 67 74 61 67 74 61 67 63 63 63 63 74 63 61
-#>  [457] 67 74 67 67 61 61 74 67 63 61 63 67 61 67 74 63 63 61 63 67 67 67 67 74
-#>  [481] 61 61 61 61 67 67 61 74 61 63 61 67 67 67 67 61 74 67 61 61 67 61 63 63
-#>  [505] 63 74 74 74 63 74 67 74 61 74 63 74 63 61 67 63 74 67 67 61 67 61 74 63
-#>  [529] 63 61 67 67 61 74 61 67 74 67 67 63 61 63 63 74 67 67 61 61 61 74 67 63
-#>  [553] 61 63 63 67 74 63 74 63 63 63 61 67 63 61 63 63 63 67 67 61 67 63 74 67
-#>  [577] 74 74 67 74 74 63 61 61 61 61 74 61 61 61 63 67 74 63 67 74 67 67 74 61
-#>  [601] 63 74 61 67 63 74 74 74 63 63 61 67 63 61 67 67 63 63 74 63 63 61 67 63
-#>  [625] 61 63 61 67 74 67 74 61 74 61 61 67 61 61 61 67 61 67 67 67 67 67 61 61
-#>  [649] 63 61 67 67 74 67 67 61 67 74 74 63 74 63 63 74 74 63 63 63 61 63 74 63
-#>  [673] 67 63 63 74 74 74 67 63 61 67 63 74 67 61 61 61 61 67 63 74 67 61 63 67
-#>  [697] 67 67 63 61 67 74 67 67 63 67 61 67 63 74 67 74 67 63 74 67 67 63 61 67
-#>  [721] 67 63 67 67 61 67 61 61 67 67 63 74 74 63 63 74 63 63 74 63 63 61 61 67
-#>  [745] 74 63 63 74 67 67 61 74 63 74 63 63 74 74 63 61 61 63 63 74 67 61 63 67
-#>  [769] 61 67 63 63 61 67 67 61 67 67 74 67 74 67 74 67 74 61 61 61 61 67 74 67
-#>  [793] 67 74 74 61 63 63 63 61 67 67 61 63 63 63 63 61 61 67 63 74 63 61 67 67
-#>  [817] 61 74 67 67 67 63 61 61 67 61 61 67 63 74 74 63 63 61 63 74 74 63 61 63
-#>  [841] 63 74 63 61 63 63 63 74 67 63 63 63 63 61 67 67 63 63 74 74 67 63 63 74
-#>  [865] 63 61 67 74 61 74 67 63 74 67 67 63 74 63 63 67 67 61 61 61 63 74 74 63
-#>  [889] 61 63 63 63 74 67 67 63 74 63 74 74 61 61 61 67 67 67 61 61 61 61 74 67
-#>  [913] 67 67 61 61 61 67 74 74 67 63 61 74 63 61 67 61 61 61 67 74 67 61 61 63
-#>  [937] 63 74 74 67 74 67 67 74 67 61 74 67 61 67 61 67 63 61 61 63 74 63 61 67
-#>  [961] 63 74 63 63 61 67 61 61 63 61 61 74 74 74 67 61 63 63 74 67 74 67 61 67
-#>  [985] 67 74 67 74 67 67 67 67 61 63 63 63 61 63 63 74
-#>  [ reached getOption("max.print") -- omitted 374 entries ]
    seqrec@dfln     # sequence definition
    #> [1] "Aotus nancymaae CD4 antigen (CD4) mRNA, complete cds"
    seqrec@ml_typ   # molecule type
    #> [1] "mRNA"
    seqrec@rec_typ  # whole record or feature
    #> [1] "whole"
    seqrec@nncltds  # sequence length
    #> [1] 1374
    seqrec@nambgs   # number of non-ATCGs
    #> [1] 0
    seqrec@pambgs   # proportion of non-ATCGs
    #> [1] 0
    seqrec@gcr      # GC-ratio
    #> [1] 0.4468705
    seqrec@age      # days since being added to GenBank
    #> [1] 3412
    # get the sequence like so....
-(rawToChar(seqrec@sq))
    #> [1] "atggatgggggaatccctttccggcacttgctcctggtgctgcaactggcgctactcccagcagtcactcacggaaagacagtggtgctgggcgaaaaaggggagacggtggagctgccctgtgaaacttccctgaagaagaacgtacaattccactggaaaacctccgaccagataaagattctgggaaatcagggctccttcttgactagaggtcaatccaagctggccgatcgcattgactcaaagaaaagctcttgggaccgaggatcctttcccctgatcatcaagaatgttcaggtagaagactcagagacttacatctgtgaagtggagagaaagaaggaggaggtggaattgcaggtgttcggattgactgccagccctgacacccacctgcttcaggggcagagcctgaccctgaccttggagagcccccctggtagtagcccctcagtggaatgcacgagtccacggggtaaaaggatacaggggatgaagaccctttctgtatctcagctggagatccaggatagtggcacctggaaatgcaccgtctcccagcacccggagctgttgttcaaaataaacgtcgtggtactagctttccagcaggcctccagcacagtgtataagaaagagggggaacaggtggagttctccttcccactcgcctttgcagctgaaaagctgacgggcagtggcgagctgtgctggcaggcggagaaggcttcctcctccaagtcctggatctccttcaacctgacgagccaggaggtgtgtgtaaaagtggttacccaggaccccaagctcaggatgggcaagaagcttccacttcacctcaccctgccccaggccttgcctcagtatgctggctccggaaacttcaccctggctcttaaagggaaaatgggaaagttgcatcagaaagtgaaccttgtggtgatgagagcaactcagctccagaacaatttgacctgtgaggtgtggggacccacctcccctaagctgatgctgagcttgaaactggagaaccaggaggcaaaggtctccaagcaggagaaggcggtgtgggtgctgaaccctgaggcgggggtgtggcagtgtctgctgagtgactcaggacaggtcctgctggaatccaaggtcgaggttctgcccacatggtctcccccggtgcagccaatggccctgattgtgccggggggtgtcgcgggcctcctggtttttactgggctaggcatcttcttctgtgtcagatgccggcatcgaaggcgccaagcagagcggatgtctcagatcaagagacttctcagtgagaagaagacctgccagtgcccccaccggtttcagaagacatgtagccccatttga"
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/TaxDict-class.html b/docs/reference/TaxDict-class.html deleted file mode 100644 index 6dc977c..0000000 --- a/docs/reference/TaxDict-class.html +++ /dev/null @@ -1,224 +0,0 @@ - - - - - - - - -Taxonomic record dictionary — TaxDict-class • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Taxonomic record dictionary

    - Source: R/all-classes.R - -
    - -
    - -

    Taxonomic dictionary contains a taxonomic -tree and NCBI taxonomy data for all taxonomic IDs.

    - -
    - - 
    # S4 method for TaxDict
-as.character(x)
-
-# S4 method for TaxDict
-show(object)
-
-# S4 method for TaxDict
-print(x)
-
-# S4 method for TaxDict
-str(object, max.level = 2L, ...)
-
-# S4 method for TaxDict
-summary(object)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - -
    x

    TaxDict object

    object

    TaxDict object

    max.level

    Maximum level of nesting for str()

    ...

    Further arguments for str()

    - -

    Slots

    - - -
    -
    txids

    Taxonomic IDs of taxon records

    -
    recs

    Environment of records

    -
    prnt

    Parent taxonomic ID

    -
    txtr

    Taxonomic tree

    -
    - -

    See also

    - -

    Other run-public: ClstrArc-class, - ClstrRec-class, - Phylota-class, SeqArc-class, - SeqRec-class, TaxRec-class, - clusters2_run, clusters_run, - parameters_reset, reset, - restart, run, - setup, taxise_run

    - - -

    Examples

    - 
    data('aotus')
-txdct <- aotus@txdct
-# this is a TaxDict object
-# it contains taxonomic information, including records and tree
-show(txdct)
    #> Taxonomic dictionary [21] recs, parent [id 9504]
    # you can access its different data slots with @
-txdct@txids  # taxonomic IDs
    #>  [1] "1263727" "1230482" "1090913" "1002694" "940829"  "867331"  "413234" 
-#>  [8] "361674"  "292213"  "280755"  "261316"  "231953"  "222417"  "120088" 
-#> [15] "57176"   "57175"   "43147"   "37293"   "30591"   "9505"    "9504"   
    txdct@recs   # taxonomic records environment
    #> <environment: 0x11dd01788>
    txdct@txtr   # taxonomic tree
    #> TreeMan Object of [19] tips
    txdct@prnt   # MRCA
    #> [1] "9504"
    # access any record through the records environment
-txdct@recs[[txdct@txids[[1]]]]
    #> TaxRec [id 1263727 (Aotus zonalis)]
    # for interacting with the taxonomic tree, see the treeman package
-summary(txdct@txtr)
    #>  Length   Class    Mode 
-#>       1 TreeMan      S4
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/TaxRec-class.html b/docs/reference/TaxRec-class.html deleted file mode 100644 index 4b2f61a..0000000 --- a/docs/reference/TaxRec-class.html +++ /dev/null @@ -1,235 +0,0 @@ - - - - - - - - -Taxonomic record — TaxRec-class • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Taxonomic record

    - Source: R/all-classes.R - -
    - -
    - -

    Taxonomic dictionary contains a taxonomic -tree and NCBI taxonomy data for all taxonomic IDs.

    - -
    - - 
    # S4 method for TaxRec
-as.character(x)
-
-# S4 method for TaxRec
-show(object)
-
-# S4 method for TaxRec
-print(x)
-
-# S4 method for TaxRec
-str(object, max.level = 2L, ...)
-
-# S4 method for TaxRec
-summary(object)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - -
    x

    TaxRec object

    object

    TaxRec object

    max.level

    Maximum level of nesting for str()

    ...

    Further arguments for str()

    - -

    Slots

    - - -
    -
    id

    Taxonomic ID

    -
    scnm

    Scientific name

    -
    cmnm

    Common name

    -
    rnk

    Rank

    -
    lng

    Lineage

    -
    prnt

    Parent

    -
    - -

    See also

    - -

    Other run-public: ClstrArc-class, - ClstrRec-class, - Phylota-class, SeqArc-class, - SeqRec-class, TaxDict-class, - clusters2_run, clusters_run, - parameters_reset, reset, - restart, run, - setup, taxise_run

    - - -

    Examples

    - 
    data('aotus')
-taxrec <- aotus@txdct@recs[[aotus@txdct@txids[[1]]]]
-# this is a TaxRec object
-# it contains NCBI's taxonomic information for a single node
-show(taxrec)
    #> TaxRec [id 1263727 (Aotus zonalis)]
    # you can access its different data slots with @
-taxrec@id    # taxonomic ID
    #> [1] "1263727"
    taxrec@scnm  # scientific name
    #> [1] "Aotus zonalis"
    taxrec@cmnm  # common name, '' if none
    #> [1] "Panamanian night monkey"
    taxrec@rnk   # rank
    #> [1] "species"
    taxrec@lng   # lineage information: list of IDs and ranks
    #> $ids
-#>  [1] "131567"  "2759"    "33154"   "33208"   "6072"    "33213"   "33511"  
-#>  [8] "7711"    "89593"   "7742"    "7776"    "117570"  "117571"  "8287"   
-#> [15] "1338369" "32523"   "32524"   "40674"   "32525"   "9347"    "1437010"
-#> [22] "314146"  "9443"    "376913"  "314293"  "9479"    "376918"  "9504"   
-#> [29] "1263727"
-#> 
-#> $rnks
-#>  [1] "no rank"      "superkingdom" "no rank"      "kingdom"      "no rank"     
-#>  [6] "no rank"      "no rank"      "phylum"       "subphylum"    "no rank"     
-#> [11] "no rank"      "no rank"      "no rank"      "superclass"   "no rank"     
-#> [16] "no rank"      "no rank"      "class"        "no rank"      "no rank"     
-#> [21] "no rank"      "superorder"   "order"        "suborder"     "infraorder"  
-#> [26] "parvorder"    "family"       "genus"        "species"     
-#> 
    taxrec@prnt  # parent ID
    #> [1] "9504"
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/aotus.rd b/docs/reference/aotus.rd deleted file mode 100644 index e23dba7..0000000 --- a/docs/reference/aotus.rd +++ /dev/null @@ -1,163 +0,0 @@ - - - - - - - - -Example phylota object (aotus) — aotus • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Example phylota object (aotus)

    - - -
    - -
    - -

    Final phylota object produced by running pipeline for the night monkeys, Aotus (9504).

    - -
    - - 
    data(aotus)
    - -

    Format

    - -

    aotus is generated from read_phylota().

    - - -

    Examples

    - 
    data(aotus) # load object
-str(aotus)
    #> Formal class 'Phylota' [package "phylotaR"] with 8 slots
-#>   ..@ cids   : chr [1:193] "0" "1" "2" "3" ...
-#>   ..@ txids  : chr [1:13] "37293" "9505" "57176" "57175" ...
-#>   ..@ sids   : chr [1:1499] "FJ623078.1" "U38998.1" "U88361.1" "AY684995.1" ...
-#>   ..@ txdct  :Formal class 'TaxDict' [package "phylotaR"] with 4 slots
-#>   ..@ sqs    :Formal class 'SeqArc' [package "phylotaR"] with 5 slots
-#>   ..@ clstrs :Formal class 'ClstrArc' [package "phylotaR"] with 2 slots
-#>   ..@ prnt_id: chr "9504"
-#>   ..@ prnt_nm: chr "Aotus"
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown.

    -
    - -
    -
    - - - - - - diff --git a/docs/reference/batcher.html b/docs/reference/batcher.html deleted file mode 100644 index d04a344..0000000 --- a/docs/reference/batcher.html +++ /dev/null @@ -1,225 +0,0 @@ - - - - - - - - -Download in batches — batcher • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Download in batches

    - Source: R/tools-api.R - -
    - -
    - -

    Run downloader function in batches for sequences or -taxonomic records

    - -
    - - 
    batcher(ids, func, ps, lvl = 0)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - -
    ids

    Vector of record ids

    func

    Downloader function

    ps

    Parameters list, generated with parameters()

    lvl

    Integer, number of message indentations indicating code -depth.

    - -

    Value

    - -

    Vector of records

    -

    vector of rentrez function results

    - -

    See also

    - -

    Other run-private: blast_clstr, - blast_filter, blast_setup, - blast_sqs, blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/blast_clstr.html b/docs/reference/blast_clstr.html deleted file mode 100644 index 96a1673..0000000 --- a/docs/reference/blast_clstr.html +++ /dev/null @@ -1,212 +0,0 @@ - - - - - - - - -Cluster BLAST Results — blast_clstr • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Cluster BLAST Results

    - Source: R/stage3-tools.R - -
    - -
    - -

    Find single-linkage clusters from BLAST results. -Identifies seed sequence.

    - -
    - - 
    blast_clstr(blast_res)
    - -

    Arguments

    - - - - - - -
    blast_res

    BLAST results

    - -

    Value

    - -

    List of list

    -

    list of cluster descriptions

    - -

    See also

    - -

    Other run-private: batcher, - blast_filter, blast_setup, - blast_sqs, blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/blast_filter.html b/docs/reference/blast_filter.html deleted file mode 100644 index 6aadf28..0000000 --- a/docs/reference/blast_filter.html +++ /dev/null @@ -1,228 +0,0 @@ - - - - - - - - -Filter BLAST results — blast_filter • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Filter BLAST results

    - Source: R/tools-blast.R - -
    - -
    - -

    Given a BLAST output, filters query-subject pairs -such that only HSPs with a coverage greater than mncvrg -(specified in the pipeline parameters) remain. Filters both: -query-subject and subject-query pairs, if one of the coverages is -insufficient. HSP coverage is obtained from the BLAST column -qcovs.

    - -
    - - 
    blast_filter(blast_res, ps, lvl = 3)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    blast_res

    BLAST results

    ps

    Parameters list, generated with parameters()

    lvl

    Integer, number of message indentations indicating code -depth.

    - -

    Value

    - -

    data.frame blast res

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_setup, - blast_sqs, blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/blast_setup.html b/docs/reference/blast_setup.html deleted file mode 100644 index 4467077..0000000 --- a/docs/reference/blast_setup.html +++ /dev/null @@ -1,225 +0,0 @@ - - - - - - - - -Ensures NCBI BLAST tools are installed — blast_setup • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Ensures NCBI BLAST tools are installed

    - Source: R/pipeline-tools.R - -
    - -
    - -

    Ensures NCBI BLAST executables are installed on the system. Tests -version number of BLAST tools.

    - -
    - - 
    blast_setup(d, v, wd)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    d

    Directory to NCBI BLAST tools

    v

    v, T/F

    wd

    Working directory

    - -

    Value

    - -

    list

    - -

    Details

    - -

    BLAST tools must be version >= 2.0

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_sqs, blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/blast_sqs.html b/docs/reference/blast_sqs.html deleted file mode 100644 index a53e751..0000000 --- a/docs/reference/blast_sqs.html +++ /dev/null @@ -1,228 +0,0 @@ - - - - - - - - -BLAST All vs All — blast_sqs • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    BLAST All vs All

    - Source: R/stage3-tools.R - -
    - -
    - -

    Return BLAST results from BLASTing all vs all for -given sequences. Returns NULL if no BLAST results generated.

    - -
    - - 
    blast_sqs(txid, typ, sqs, ps, lvl)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - -
    txid

    Taxonomic node ID, numeric

    typ

    Cluster type, 'direct' or 'subtree'

    sqs

    Sequences

    ps

    Parameters list, generated with parameters()

    lvl

    Integer, number of message indentations indicating code -depth.

    - -

    Value

    - -

    blast_res data.frame or NULL

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/blastcache_load.html b/docs/reference/blastcache_load.html deleted file mode 100644 index 9a44141..0000000 --- a/docs/reference/blastcache_load.html +++ /dev/null @@ -1,213 +0,0 @@ - - - - - - - - -Load BLAST results from cache — blastcache_load • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Load BLAST results from cache

    - Source: R/tools-cache.R - -
    - -
    - -

    Run to load cached BLAST results.

    - -
    - - 
    blastcache_load(sids, wd)
    - -

    Arguments

    - - - - - - - - - - -
    sids

    Sequence IDs

    wd

    Working dir

    - -

    Value

    - -

    blast_res data.frame or NULL

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/blastcache_save.html b/docs/reference/blastcache_save.html deleted file mode 100644 index 5f16e40..0000000 --- a/docs/reference/blastcache_save.html +++ /dev/null @@ -1,213 +0,0 @@ - - - - - - - - -Save BLAST results to cache — blastcache_save • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Save BLAST results to cache

    - Source: R/tools-cache.R - -
    - -
    - -

    Run whenever local BLAST runs are made to save results -in cache in case the pipeline is run again.

    - -
    - - 
    blastcache_save(sids, wd, obj)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    sids

    Sequence IDs

    wd

    Working dir

    obj

    BLAST result

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/blastdb_gen.html b/docs/reference/blastdb_gen.html deleted file mode 100644 index 2f26276..0000000 --- a/docs/reference/blastdb_gen.html +++ /dev/null @@ -1,211 +0,0 @@ - - - - - - - - -Generate a BLAST database — blastdb_gen • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Generate a BLAST database

    - Source: R/tools-blast.R - -
    - -
    - -

    Generate BLAST database in wd for given sequences.

    - -
    - - 
    blastdb_gen(sqs, dbfl, ps)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    sqs

    Sequences

    dbfl

    Outfile for database

    ps

    Parameters list, generated with parameters()

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastn_run, - cache_rm, cache_setup, - clade_select, clstr2_calc, - clstr_all, clstr_direct, - clstr_sqs, clstr_subtree, - clstrarc_gen, clstrarc_join, - clstrrec_gen, clstrs_calc, - clstrs_join, clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/blastn_run.html b/docs/reference/blastn_run.html deleted file mode 100644 index b4998c2..0000000 --- a/docs/reference/blastn_run.html +++ /dev/null @@ -1,213 +0,0 @@ - - - - - - - - -Launch blastn — blastn_run • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Launch blastn

    - Source: R/tools-blast.R - -
    - -
    - -

    Use blastn to BLAST all-vs-all using a BLAST -database.

    - -
    - - 
    blastn_run(dbfl, outfl, ps)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    dbfl

    Database file

    outfl

    Output file

    ps

    Parameters list, generated with parameters()

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - cache_rm, cache_setup, - clade_select, clstr2_calc, - clstr_all, clstr_direct, - clstr_sqs, clstr_subtree, - clstrarc_gen, clstrarc_join, - clstrrec_gen, clstrs_calc, - clstrs_join, clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/blst_rs.html b/docs/reference/blst_rs.html deleted file mode 100644 index ffcca2a..0000000 --- a/docs/reference/blst_rs.html +++ /dev/null @@ -1,185 +0,0 @@ - - - - - - - - -Example BLAST Results — blst_rs • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Example BLAST Results

    - - -
    - -
    - -

    Simple BLAST results for testing and examples.

    - -
    - - 
    data(blst_rs)
    - -

    Format

    - -

    blst_rs is a produced by a blast function.

    - - -

    Examples

    - 
    data(blst_rs) # load object
-summary(blst_rs)
    #>     query.id           subject.id           identity      alignment.length
-#>  Min.   :1.279e+09   Min.   :1.279e+09   Min.   : 86.33   Min.   :1037    
-#>  1st Qu.:1.279e+09   1st Qu.:1.279e+09   1st Qu.: 88.04   1st Qu.:1037    
-#>  Median :1.279e+09   Median :1.279e+09   Median : 91.36   Median :1039    
-#>  Mean   :1.279e+09   Mean   :1.279e+09   Mean   : 92.36   Mean   :1039    
-#>  3rd Qu.:1.279e+09   3rd Qu.:1.279e+09   3rd Qu.: 95.56   3rd Qu.:1041    
-#>  Max.   :1.279e+09   Max.   :1.279e+09   Max.   :100.00   Max.   :1043    
-#>    mismatches       gap.opens       q.start         q.end         s.start    
-#>  Min.   :  0.00   Min.   :0.00   Min.   :1.00   Min.   :1032   Min.   :1.00  
-#>  1st Qu.: 46.00   1st Qu.:0.00   1st Qu.:1.00   1st Qu.:1037   1st Qu.:1.00  
-#>  Median : 82.00   Median :2.00   Median :1.00   Median :1037   Median :1.00  
-#>  Mean   : 75.66   Mean   :2.74   Mean   :1.32   Mean   :1038   Mean   :1.32  
-#>  3rd Qu.:122.00   3rd Qu.:5.00   3rd Qu.:2.00   3rd Qu.:1040   3rd Qu.:2.00  
-#>  Max.   :136.00   Max.   :9.00   Max.   :2.00   Max.   :1040   Max.   :2.00  
-#>      s.end          evalue    bit.score        qcovs           qcovhsp      
-#>  Min.   :1032   Min.   :0   Min.   :1125   Min.   : 99.00   Min.   : 99.00  
-#>  1st Qu.:1037   1st Qu.:0   1st Qu.:1227   1st Qu.: 99.00   1st Qu.: 99.00  
-#>  Median :1037   Median :0   Median :1417   Median :100.00   Median :100.00  
-#>  Mean   :1038   Mean   :0   Mean   :1476   Mean   : 99.54   Mean   : 99.54  
-#>  3rd Qu.:1040   3rd Qu.:0   3rd Qu.:1661   3rd Qu.:100.00   3rd Qu.:100.00  
-#>  Max.   :1040   Max.   :0   Max.   :1921   Max.   :100.00   Max.   :100.00
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown.

    -
    - -
    -
    - - - - - - diff --git a/docs/reference/bromeliads.rd b/docs/reference/bromeliads.rd deleted file mode 100644 index 65beca0..0000000 --- a/docs/reference/bromeliads.rd +++ /dev/null @@ -1,163 +0,0 @@ - - - - - - - - -Example phylota object (bromeliads) — bromeliads • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Example phylota object (bromeliads)

    - - -
    - -
    - -

    Final phylota object produced by running pipeline for the bromeliads, Bromeliaceae (4613).

    - -
    - - 
    data(bromeliads)
    - -

    Format

    - -

    bromeliads is generated from read_phylota().

    - - -

    Examples

    - 
    data(bromeliads) # load object
-str(bromeliads)
    #> Formal class 'Phylota' [package "phylotaR"] with 8 slots
-#>   ..@ cids   : chr [1:721] "0" "1" "2" "3" ...
-#>   ..@ txids  : chr [1:1172] "100681" "1349380" "1485041" "1485031" ...
-#>   ..@ sids   : chr [1:9840] "AF162230.2/1..1536" "AY438602.1" "HQ913671.1/54..670" "HQ882722.1/1..573" ...
-#>   ..@ txdct  :Formal class 'TaxDict' [package "phylotaR"] with 4 slots
-#>   ..@ sqs    :Formal class 'SeqArc' [package "phylotaR"] with 5 slots
-#>   ..@ clstrs :Formal class 'ClstrArc' [package "phylotaR"] with 2 slots
-#>   ..@ prnt_id: chr "4613"
-#>   ..@ prnt_nm: chr "Bromeliaceae"
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown.

    -
    - -
    -
    - - - - - - diff --git a/docs/reference/cache_rm.html b/docs/reference/cache_rm.html deleted file mode 100644 index 29d3d47..0000000 --- a/docs/reference/cache_rm.html +++ /dev/null @@ -1,203 +0,0 @@ - - - - - - - - -Delete a cache — cache_rm • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Delete a cache

    - Source: R/tools-cache.R - -
    - -
    - -

    Deletes a cache from a wd.

    - -
    - - 
    cache_rm(wd)
    - -

    Arguments

    - - - - - - -
    wd

    Working directory

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_setup, - clade_select, clstr2_calc, - clstr_all, clstr_direct, - clstr_sqs, clstr_subtree, - clstrarc_gen, clstrarc_join, - clstrrec_gen, clstrs_calc, - clstrs_join, clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/cache_setup.html b/docs/reference/cache_setup.html deleted file mode 100644 index a591591..0000000 --- a/docs/reference/cache_setup.html +++ /dev/null @@ -1,214 +0,0 @@ - - - - - - - - -Set-up a cache — cache_setup • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Set-up a cache

    - Source: R/tools-cache.R - -
    - -
    - -

    Creates a cache of parameters in the wd.

    - -
    - - 
    cache_setup(ps, ovrwrt = FALSE)
    - -

    Arguments

    - - - - - - - - - - -
    ps

    Parameters list, generated with parameters()

    ovrwrt

    Overwrite existing cache? Default FALSE.

    - -

    Details

    - -

    Warning: overwriting with this function will delete the -existing cache.

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - clade_select, clstr2_calc, - clstr_all, clstr_direct, - clstr_sqs, clstr_subtree, - clstrarc_gen, clstrarc_join, - clstrrec_gen, clstrs_calc, - clstrs_join, clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/calc_mad.html b/docs/reference/calc_mad.html deleted file mode 100644 index 6923af1..0000000 --- a/docs/reference/calc_mad.html +++ /dev/null @@ -1,205 +0,0 @@ - - - - - - - - -Calculate MAD score — calc_mad • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Calculate MAD score

    - Source: R/user-calc.R - -
    - -
    - -

    For all sequences in a cluster(s) the MAD score.

    - -
    - - 
    calc_mad(phylota, cid)
    - -

    Arguments

    - - - - - - - - - - -
    phylota

    Phylota object

    cid

    Cluster ID(s)

    - -

    Value

    - -

    vector

    - -

    Details

    - -

    MAD is a measure of the deviation in sequence length of a cluster. -Values range from 0 to 1. Clusters with values close to 1 have sequences with -similar lengths.

    - -

    See also

    - -

    Other tools-public: calc_wrdfrq, - drop_by_rank, drop_clstrs, - drop_sqs, get_clstr_slot, - get_nsqs, get_ntaxa, - get_sq_slot, get_stage_times, - get_tx_slot, get_txids, - is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -

    Examples

    - 
    data("bromeliads")
-random_cids <- sample(bromeliads@cids, 10)
-(calc_mad(phylota = bromeliads, cid = random_cids))
    #>        58       600       431       112         5       333       355       206 
-#> 0.8665485 0.8130081 1.0000000 0.8357875 0.7380149 0.8671407 0.9665566 0.9983308 
-#>       522       550 
-#> 0.9262367 1.0000000
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/calc_wrdfrq.html b/docs/reference/calc_wrdfrq.html deleted file mode 100644 index 50b5eff..0000000 --- a/docs/reference/calc_wrdfrq.html +++ /dev/null @@ -1,304 +0,0 @@ - - - - - - - - -Calculate word frequencies — calc_wrdfrq • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Calculate word frequencies

    - Source: R/user-calc.R - -
    - -
    - -

    For all sequences in a cluster(s) calculate the frequency of -separate words in either the sequence definitions or the reported feature -name.

    - -
    - - 
    calc_wrdfrq(phylota, cid, min_frq = 0.1, min_nchar = 1,
-  type = c("dfln", "nm"), ignr_pttrn = "[^a-z0-9]")
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - - - - - -
    phylota

    Phylota object

    cid

    Cluster ID(s)

    min_frq

    Minimum frequency

    min_nchar

    Minimum number of characters for a word

    type

    Definitions (dfln) or features (nm)

    ignr_pttrn

    Ignore pattern, REGEX for text to ignore.

    - -

    Value

    - -

    list

    - -

    Details

    - -

    By default, anything that is not alphanumeric is ignored. 'dfln' -and 'nm' match the slot names in a SeqRec, see list_seqrec_slots().

    - -

    See also

    - -

    Other tools-public: calc_mad, - drop_by_rank, drop_clstrs, - drop_sqs, get_clstr_slot, - get_nsqs, get_ntaxa, - get_sq_slot, get_stage_times, - get_tx_slot, get_txids, - is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -

    Examples

    - 
    data('dragonflies')
-# work out what gene region the cluster is likely representing with word freqs.
-random_cids <- sample(dragonflies@cids, 10)
-# most frequent words in definition line
-(calc_wrdfrq(phylota = dragonflies, cid = random_cids, type = 'dfln'))
    #> $`685`
-#> named numeric(0)
-#> 
-#> $`136`
-#> named numeric(0)
-#> 
-#> $`26`
-#> wrds
-#>        h3      gene   partial       cds   histone 
-#> 0.1487768 0.1118323 0.1118323 0.1113330 0.1113330 
-#> 
-#> $`250`
-#>  sequence 
-#> 0.1363636 
-#> 
-#> $`313`
-#> named numeric(0)
-#> 
-#> $`152`
-#> wrds
-#>      rrna       and 
-#> 0.1543739 0.1029160 
-#> 
-#> $`779`
-#> wrds
-#>      rrna       and 
-#> 0.1578947 0.1052632 
-#> 
-#> $`49`
-#> named numeric(0)
-#> 
-#> $`301`
-#> wrds
-#>       18s      gene   partial ribosomal       rna  sequence 
-#> 0.1181818 0.1181818 0.1181818 0.1181818 0.1181818 0.1181818 
-#> 
-#> $`756`
-#> wrds
-#>      gene  sequence 
-#> 0.1451613 0.1451613 
-#> 
    # most frequent words in feature name
-(calc_wrdfrq(phylota = dragonflies, cid = random_cids, type = 'nm'))
    #> $`685`
-#> numeric(0)
-#> 
-#> $`136`
-#> numeric(0)
-#> 
-#> $`26`
-#> numeric(0)
-#> 
-#> $`250`
-#> wrds
-#>         28s         and    contains    internal   ribosomal         rna 
-#>       0.125       0.125       0.125       0.125       0.125       0.125 
-#>      spacer transcribed 
-#>       0.125       0.125 
-#> 
-#> $`313`
-#> numeric(0)
-#> 
-#> $`152`
-#> wrds
-#>    internal      spacer transcribed 
-#>   0.3333333   0.3333333   0.3333333 
-#> 
-#> $`779`
-#> wrds
-#>    internal      spacer transcribed 
-#>   0.3333333   0.3333333   0.3333333 
-#> 
-#> $`49`
-#> numeric(0)
-#> 
-#> $`301`
-#> numeric(0)
-#> 
-#> $`756`
-#> wrds
-#>       16s ribosomal       rna 
-#> 0.3333333 0.3333333 0.3333333 
-#>
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/clade_select.html b/docs/reference/clade_select.html deleted file mode 100644 index dcbb49e..0000000 --- a/docs/reference/clade_select.html +++ /dev/null @@ -1,215 +0,0 @@ - - - - - - - - -Get all node IDs that will be processed — clade_select • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Get all node IDs that will be processed

    - Source: R/stage2.R - -
    - -
    - -

    All nodes with less than maximum number -of nodes and sequences.

    - -
    - - 
    clade_select(txdct, ps)
    - -

    Arguments

    - - - - - - - - - - -
    txdct

    TxDct

    ps

    Parameters list, generated with parameters()

    - -

    Value

    - -

    vector of txids

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clstr2_calc, - clstr_all, clstr_direct, - clstr_sqs, clstr_subtree, - clstrarc_gen, clstrarc_join, - clstrrec_gen, clstrs_calc, - clstrs_join, clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/clstr2_calc.html b/docs/reference/clstr2_calc.html deleted file mode 100644 index 84ecb52..0000000 --- a/docs/reference/clstr2_calc.html +++ /dev/null @@ -1,209 +0,0 @@ - - - - - - - - -Cluster sets of clusters identified in cluster stage — clstr2_calc • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Cluster sets of clusters identified in cluster stage

    - Source: R/stage4.R - -
    - -
    - -

    Loads cluster sets from cache. Extracts seed sequences -and runs all-v-all BLAST of seeds to identify sister clusters. -Sisters are then merged. An object of all sequences and clusters -is then saved in cache.

    - -
    - - 
    clstr2_calc(ps)
    - -

    Arguments

    - - - - - - -
    ps

    Parameters list, generated with parameters()

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr_all, clstr_direct, - clstr_sqs, clstr_subtree, - clstrarc_gen, clstrarc_join, - clstrrec_gen, clstrs_calc, - clstrs_join, clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/clstr_all.html b/docs/reference/clstr_all.html deleted file mode 100644 index 81bae9e..0000000 --- a/docs/reference/clstr_all.html +++ /dev/null @@ -1,226 +0,0 @@ - - - - - - - - -Hierarchically cluster all sequences of a txid — clstr_all • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Hierarchically cluster all sequences of a txid

    - Source: R/stage3-tools.R - -
    - -
    - -

    Identifies all direct and subtree clusters for a taxonomic ID.

    - -
    - - 
    clstr_all(txid, sqs, txdct, ps, lvl = 0)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - -
    txid

    Taxonomic ID

    sqs

    Sequence object of all downloaded sequences

    txdct

    Taxonomic dictionary

    ps

    Parameters list, generated with parameters()

    lvl

    Integer, number of message indentations indicating code -depth.

    - -

    Value

    - -

    ClstrArc

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_direct, - clstr_sqs, clstr_subtree, - clstrarc_gen, clstrarc_join, - clstrrec_gen, clstrs_calc, - clstrs_join, clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/clstr_direct.html b/docs/reference/clstr_direct.html deleted file mode 100644 index 1c98fd5..0000000 --- a/docs/reference/clstr_direct.html +++ /dev/null @@ -1,234 +0,0 @@ - - - - - - - - -Cluster sequences directly associated with txid — clstr_direct • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Cluster sequences directly associated with txid

    - Source: R/stage3-tools.R - -
    - -
    - -

    In GenBank certain sequences may only be associated -with a higher level taxon (e.g. genus, family ...). This function -generates clusters from these sequences, alone. This function -identifies such sequences in the sequence object and generates -a list of clusters of cl_type 'direct'.

    - -
    - - 
    clstr_direct(txid, sqs, txdct, ps, lvl)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - -
    txid

    Taxonomic ID

    sqs

    Sequence object of all downloaded sequences

    txdct

    Taxonomic dictionary

    ps

    Parameters list, generated with parameters()

    lvl

    Integer, number of message indentations indicating code -depth.

    - -

    Value

    - -

    ClstrArc

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_sqs, clstr_subtree, - clstrarc_gen, clstrarc_join, - clstrrec_gen, clstrs_calc, - clstrs_join, clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/clstr_sqs.html b/docs/reference/clstr_sqs.html deleted file mode 100644 index a93caf4..0000000 --- a/docs/reference/clstr_sqs.html +++ /dev/null @@ -1,222 +0,0 @@ - - - - - - - - -Identify clusters from sequences — clstr_sqs • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Identify clusters from sequences

    - Source: R/stage3-tools.R - -
    - -
    - -

    Given a sequence object, this function will generate -a list of cluster objects using BLAST

    - -
    - - 
    clstr_sqs(txid, sqs, ps, lvl, typ = c("direct", "subtree", "paraphyly"))
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - -
    txid

    Taxonomic ID

    sqs

    Sequence object of sequences to be BLASTed

    ps

    Parameters list, generated with parameters()

    lvl

    Integer, number of message indentations indicating code -depth.

    typ

    Direct, subtree or paraphyly?

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_subtree, - clstrarc_gen, clstrarc_join, - clstrrec_gen, clstrs_calc, - clstrs_join, clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/clstr_subtree.html b/docs/reference/clstr_subtree.html deleted file mode 100644 index c950471..0000000 --- a/docs/reference/clstr_subtree.html +++ /dev/null @@ -1,234 +0,0 @@ - - - - - - - - -Cluster all sequences descending from a txid — clstr_subtree • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Cluster all sequences descending from a txid

    - Source: R/stage3-tools.R - -
    - -
    - -

    Identifies clusters from sequences associated with a -txid and all its descendants. Clusters returned by this function -will thus be of cl_type 'subtree'.

    - -
    - - 
    clstr_subtree(txid, sqs, txdct, dds, ps, lvl)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - - - - - -
    txid

    Taxonomic ID

    sqs

    Sequence object of all downloaded sequences

    txdct

    Taxonomic dictionary

    dds

    Vector of direct descendants

    ps

    Parameters list, generated with parameters()

    lvl

    Integer, number of message indentations indicating code -depth.

    - -

    Value

    - -

    ClstrArc

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstrarc_gen, clstrarc_join, - clstrrec_gen, clstrs_calc, - clstrs_join, clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/clstrarc_gen.html b/docs/reference/clstrarc_gen.html deleted file mode 100644 index 47330a2..0000000 --- a/docs/reference/clstrarc_gen.html +++ /dev/null @@ -1,209 +0,0 @@ - - - - - - - - -Generate cluster archive container class — clstrarc_gen • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Generate cluster archive container class

    - Source: R/stage3-tools.R - -
    - -
    - -

    Takes a list of ClstrRecs, returns a ClstrArc.

    - -
    - - 
    clstrarc_gen(clstrrecs)
    - -

    Arguments

    - - - - - - -
    clstrrecs

    list of ClstrRecs

    - -

    Value

    - -

    ClstrArc

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_join, - clstrrec_gen, clstrs_calc, - clstrs_join, clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/clstrarc_join.html b/docs/reference/clstrarc_join.html deleted file mode 100644 index 2041297..0000000 --- a/docs/reference/clstrarc_join.html +++ /dev/null @@ -1,215 +0,0 @@ - - - - - - - - -Join two cluster archive — clstrarc_join • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Join two cluster archive

    - Source: R/stage3-tools.R - -
    - -
    - -

    Take two ClstrArc classes and join them into a single -ClstrArc.

    - -
    - - 
    clstrarc_join(clstrarc_1, clstrarc_2)
    - -

    Arguments

    - - - - - - - - - - -
    clstrarc_1

    ClstrArc

    clstrarc_2

    ClstrArc

    - -

    Value

    - -

    ClstrArc

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrrec_gen, clstrs_calc, - clstrs_join, clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/clstrrec_gen.html b/docs/reference/clstrrec_gen.html deleted file mode 100644 index 0827b2f..0000000 --- a/docs/reference/clstrrec_gen.html +++ /dev/null @@ -1,223 +0,0 @@ - - - - - - - - -Generate list of clusters — clstrrec_gen • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Generate list of clusters

    - Source: R/stage3-tools.R - -
    - -
    - -

    Takes a list of lists of cluster descriptions -and generates ClstrRecs.

    - -
    - - 
    clstrrec_gen(clstr_list, txid, sqs, typ)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - -
    clstr_list

    List of list of cluster descriptions

    txid

    Taxonomic node ID

    sqs

    Sequence records

    typ

    Cluster type

    - -

    Value

    - -

    list of ClstrRecs

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrs_calc, - clstrs_join, clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/clstrs_calc.html b/docs/reference/clstrs_calc.html deleted file mode 100644 index 5dc4bb3..0000000 --- a/docs/reference/clstrs_calc.html +++ /dev/null @@ -1,209 +0,0 @@ - - - - - - - - -Calculate clusters for all sequences in wd — clstrs_calc • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Calculate clusters for all sequences in wd

    - Source: R/stage3.R - -
    - -
    - -

    Loop through downloaded sequences for each clade and -hierarchically find clusters using BLAST.

    - -
    - - 
    clstrs_calc(txdct, ps)
    - -

    Arguments

    - - - - - - - - - - -
    txdct

    Taxonomic dictionary

    ps

    Parameters list, generated with parameters()

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_join, clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/clstrs_join.html b/docs/reference/clstrs_join.html deleted file mode 100644 index ece0498..0000000 --- a/docs/reference/clstrs_join.html +++ /dev/null @@ -1,227 +0,0 @@ - - - - - - - - -Join clusters for merging — clstrs_join • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Join clusters for merging

    - Source: R/stage4-tools.R - -
    - -
    - -

    Uses seed sequence BLAST results and IDs to join clusters -identified as sisters into single clusters. Resulting object is of joined -clusters, merging is required to reformat the clusters for subsequent -analysis.

    - -
    - - 
    clstrs_join(blast_res, seed_ids, all_clstrs, ps)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - -
    blast_res

    Seed sequence BLAST results

    seed_ids

    Seed sequence IDs

    all_clstrs

    List of all clusters

    ps

    Parameters list, generated with parameters()

    - -

    Value

    - -

    list of joined clusters

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/clstrs_merge.html b/docs/reference/clstrs_merge.html deleted file mode 100644 index 6d8c7b5..0000000 --- a/docs/reference/clstrs_merge.html +++ /dev/null @@ -1,217 +0,0 @@ - - - - - - - - -Merge joined clusters — clstrs_merge • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Merge joined clusters

    - Source: R/stage4-tools.R - -
    - -
    - -

    Takes a list of joined clusters and computes each -data slot to create a single merged cluster. txdct is required for -parent look-up.

    - -
    - - 
    clstrs_merge(jnd_clstrs, txdct)
    - -

    Arguments

    - - - - - - - - - - -
    jnd_clstrs

    List of joined clusters

    txdct

    Taxonomic dictionary

    - -

    Value

    - -

    list of ClstrRecs

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/clstrs_renumber.html b/docs/reference/clstrs_renumber.html deleted file mode 100644 index 50d7103..0000000 --- a/docs/reference/clstrs_renumber.html +++ /dev/null @@ -1,211 +0,0 @@ - - - - - - - - -Renumber cluster IDs — clstrs_renumber • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Renumber cluster IDs

    - Source: R/stage4-tools.R - -
    - -
    - -

    Returns a ClstrArc with ID determined by the number -of sequences in each cluster.

    - -
    - - 
    clstrs_renumber(clstrrecs)
    - -

    Arguments

    - - - - - - -
    clstrrecs

    List of clusters

    - -

    Value

    - -

    ClstrArc

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/clstrs_save.html b/docs/reference/clstrs_save.html deleted file mode 100644 index bc3481a..0000000 --- a/docs/reference/clstrs_save.html +++ /dev/null @@ -1,212 +0,0 @@ - - - - - - - - -Save clusters to cache — clstrs_save • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Save clusters to cache

    - Source: R/tools-cache.R - -
    - -
    - -

    Saves clusters generated by clstr_all to cache.

    - -
    - - 
    clstrs_save(wd, txid, clstrs)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    wd

    Working directory

    txid

    Taxonomic ID, numeric

    clstrs

    cluster list

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, cmdln, - descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/clusters2_run.html b/docs/reference/clusters2_run.html deleted file mode 100644 index 08705ce..0000000 --- a/docs/reference/clusters2_run.html +++ /dev/null @@ -1,196 +0,0 @@ - - - - - - - - -Run the cluster2 stage — clusters2_run • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Run the cluster2 stage

    - Source: R/stage4.R - -
    - -
    - -

    Run the fourth stage of the phylotaR pipeline, -cluster2. Identify clusters at higher taxonomic levels by -merging sister clusters.

    - -
    - - 
    clusters2_run(wd)
    - -

    Arguments

    - - - - - - -
    wd

    Working directory

    - -

    See also

    - -

    Other run-public: ClstrArc-class, - ClstrRec-class, - Phylota-class, SeqArc-class, - SeqRec-class, TaxDict-class, - TaxRec-class, clusters_run, - parameters_reset, reset, - restart, run, - setup, taxise_run

    - - -

    Examples

    - 
    # NOT RUN {
-
-  # Note: this example requires BLAST and internet to run.
-
-  # example with temp folder
-  wd <- file.path(tempdir(), 'aotus')
-  # setup for aotus, make sure aotus/ folder already exists
-  if (!dir.exists(wd)) {
-    dir.create(wd)
-  }
-  ncbi_dr <- '[SET BLAST+ BIN PATH HERE]'
-  setup(wd = wd, txid = 9504, ncbi_dr = ncbi_dr)  # txid for Aotus primate genus
-  # individually run stages
-  taxise_run(wd = wd)
-  download_run(wd = wd)
-  clusters_run(wd = wd)
-  clusters2_run(wd = wd)
-# }
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/clusters_run.html b/docs/reference/clusters_run.html deleted file mode 100644 index 03b0db9..0000000 --- a/docs/reference/clusters_run.html +++ /dev/null @@ -1,199 +0,0 @@ - - - - - - - - -Run the cluster stage — clusters_run • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Run the cluster stage

    - Source: R/stage3.R - -
    - -
    - -

    Run the third stage of the phylotaR pipeline, cluster. -This stage hierarchically traverses the taxonomy identifying all -direct and subtree clusters from downloaded sequences. Any -taxonomic nodes too small for cluster identification are placed -into paraphyletic clusters.

    - -
    - - 
    clusters_run(wd)
    - -

    Arguments

    - - - - - - -
    wd

    Working directory

    - -

    See also

    - -

    Other run-public: ClstrArc-class, - ClstrRec-class, - Phylota-class, SeqArc-class, - SeqRec-class, TaxDict-class, - TaxRec-class, clusters2_run, - parameters_reset, reset, - restart, run, - setup, taxise_run

    - - -

    Examples

    - 
    # NOT RUN {
-
-  # Note: this example requires BLAST and internet to run.
-
-  # example with temp folder
-  wd <- file.path(tempdir(), 'aotus')
-  # setup for aotus, make sure aotus/ folder already exists
-  if (!dir.exists(wd)) {
-    dir.create(wd)
-  }
-  ncbi_dr <- '[SET BLAST+ BIN PATH HERE]'
-  setup(wd = wd, txid = 9504, ncbi_dr = ncbi_dr)  # txid for Aotus primate genus
-  # individually run stages
-  taxise_run(wd = wd)
-  download_run(wd = wd)
-  clusters_run(wd = wd)
-# }
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/cmdln.html b/docs/reference/cmdln.html deleted file mode 100644 index 0cad2dc..0000000 --- a/docs/reference/cmdln.html +++ /dev/null @@ -1,234 +0,0 @@ - - - - - - - - -Run a command via terminal/command prompt — cmdln • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Run a command via terminal/command prompt

    - Source: R/tools-system.R - -
    - -
    - -

    Provide the command and arguments as a vector. -Also can take a lgfl to which all stdout and stderr is written. -If lgfl is not provided, a list is returned of 'status', 'stdout' -and 'stderr'. Else only the status is returned - 1 success, 0 -failed.

    - -
    - - 
    cmdln(cmd, args, lgfl = NULL)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    cmd

    Command to be run

    args

    Vector of command arguments, each parameter and value -must be a separate element

    lgfl

    File to which stdout/err will be written

    - -

    Value

    - -

    status, integer or character

    - -

    Details

    - -

    Note, stdout/err are returned as 'raw'. Use rawToChar() to -convert to characters.

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/cycads.rd b/docs/reference/cycads.rd deleted file mode 100644 index e339c3c..0000000 --- a/docs/reference/cycads.rd +++ /dev/null @@ -1,163 +0,0 @@ - - - - - - - - -Example phylota object (cycads) — cycads • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Example phylota object (cycads)

    - - -
    - -
    - -

    Final phylota object produced by running pipeline for the cycads, Cycadidae (1445963).

    - -
    - - 
    data(cycads)
    - -

    Format

    - -

    cycads is generated from read_phylota().

    - - -

    Examples

    - 
    data(cycads) # load object
-str(cycads)
    #> Formal class 'Phylota' [package "phylotaR"] with 8 slots
-#>   ..@ cids   : chr [1:540] "0" "1" "2" "3" ...
-#>   ..@ txids  : chr [1:353] "933395" "747353" "933394" "171016" ...
-#>   ..@ sids   : chr [1:8331] "GU250484.1" "GU250483.1" "GU250482.1" "GU250481.1" ...
-#>   ..@ txdct  :Formal class 'TaxDict' [package "phylotaR"] with 4 slots
-#>   ..@ sqs    :Formal class 'SeqArc' [package "phylotaR"] with 5 slots
-#>   ..@ clstrs :Formal class 'ClstrArc' [package "phylotaR"] with 2 slots
-#>   ..@ prnt_id: chr "1445963"
-#>   ..@ prnt_nm: chr "Cycadidae"
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown.

    -
    - -
    -
    - - - - - - diff --git a/docs/reference/descendants_get.html b/docs/reference/descendants_get.html deleted file mode 100644 index 3d08b98..0000000 --- a/docs/reference/descendants_get.html +++ /dev/null @@ -1,219 +0,0 @@ - - - - - - - - -Get descendants — descendants_get • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Get descendants

    - Source: R/tools-txdct.R - -
    - -
    - -

    Look-up either direct or all taxonomic descendants of -a node from taxonomic dictionary.

    - -
    - - 
    descendants_get(id, txdct, direct = FALSE)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    id

    txid

    txdct

    TaxDict

    direct

    T/F, return only direct descendants?

    - -

    Value

    - -

    vector

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, download_obj_check, - error, gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/download_obj_check.html b/docs/reference/download_obj_check.html deleted file mode 100644 index d126418..0000000 --- a/docs/reference/download_obj_check.html +++ /dev/null @@ -1,211 +0,0 @@ - - - - - - - - -Check an object returned from rentrez function — download_obj_check • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Check an object returned from rentrez function

    - Source: R/tools-api.R - -
    - -
    - -

    Returns T/F. Checks if object returned from rentrez -function is as expected.

    - -
    - - 
    download_obj_check(obj)
    - -

    Arguments

    - - - - - - -
    obj

    Object returned from rentrez function

    - -

    Value

    - -

    T/F

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - error, gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/download_run.html b/docs/reference/download_run.html deleted file mode 100644 index 5a32d9c..0000000 --- a/docs/reference/download_run.html +++ /dev/null @@ -1,183 +0,0 @@ - - - - - - - - -Run download stage — download_run • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Run download stage

    - Source: R/stage2.R - -
    - -
    - -

    Run the second stage of phylotaR, download. This stage -downloads sequences for all nodes with sequence numbers less than -mxsqs. It hierarchically traverses the taxonomy for each node and -downloads direct and subtree sequences for all descendants.

    - -
    - - 
    download_run(wd)
    - -

    Arguments

    - - - - - - -
    wd

    Working directory

    - - -

    Examples

    - 
    # NOT RUN {
-
-  # Note: this example requires BLAST and internet to run.
-
-  # example with temp folder
-  wd <- file.path(tempdir(), 'aotus')
-  # setup for aotus, make sure aotus/ folder already exists
-  if (!dir.exists(wd)) {
-    dir.create(wd)
-  }
-  ncbi_dr <- '[SET BLAST+ BIN PATH HERE]'
-  setup(wd = wd, txid = 9504, ncbi_dr = ncbi_dr)  # txid for Aotus primate genus
-  # individually run stages
-  taxise_run(wd = wd)
-  download_run(wd = wd)
-# }
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/dragonflies.rd b/docs/reference/dragonflies.rd deleted file mode 100644 index e1b9196..0000000 --- a/docs/reference/dragonflies.rd +++ /dev/null @@ -1,163 +0,0 @@ - - - - - - - - -Example phylota object (dragonflies) — dragonflies • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Example phylota object (dragonflies)

    - - -
    - -
    - -

    Final phylota object produced by running pipeline for the dragonflies, Anisoptera (6962).

    - -
    - - 
    data(dragonflies)
    - -

    Format

    - -

    dragonflies is generated from read_phylota().

    - - -

    Examples

    - 
    data(dragonflies) # load object
-str(dragonflies)
    #> Formal class 'Phylota' [package "phylotaR"] with 8 slots
-#>   ..@ cids   : chr [1:784] "0" "1" "2" "3" ...
-#>   ..@ txids  : chr [1:1143] "1080975" "476805" "126213" "476689" ...
-#>   ..@ sids   : chr [1:10619] "JN615256.1" "EU055352.1" "EU055329.1" "EU055461.1" ...
-#>   ..@ txdct  :Formal class 'TaxDict' [package "phylotaR"] with 4 slots
-#>   ..@ sqs    :Formal class 'SeqArc' [package "phylotaR"] with 5 slots
-#>   ..@ clstrs :Formal class 'ClstrArc' [package "phylotaR"] with 2 slots
-#>   ..@ prnt_id: chr "6962"
-#>   ..@ prnt_nm: chr "Anisoptera"
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown.

    -
    - -
    -
    - - - - - - diff --git a/docs/reference/drop_by_rank.html b/docs/reference/drop_by_rank.html deleted file mode 100644 index eb72378..0000000 --- a/docs/reference/drop_by_rank.html +++ /dev/null @@ -1,262 +0,0 @@ - - - - - - - - -Reduce clusters to specific rank — drop_by_rank • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Reduce clusters to specific rank

    - Source: R/user-drop.R - -
    - -
    - -

    Identifies higher level taxa for each sequence in clusters for -given rank. Selects representative sequences for each unique taxon using the -choose_by functions. By default, the function will choose the top ten -sequences by first sorting by those with fewest number of ambiguous -sequences, then by youngest, then by sequence length.

    - -
    - - 
    drop_by_rank(phylota, rnk = "species", keep_higher = FALSE, n = 10,
-  choose_by = c("pambgs", "age", "nncltds"), greatest = c(FALSE, FALSE,
-  TRUE))
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - - - - - -
    phylota

    Phylota object

    rnk

    Taxonomic rank

    keep_higher

    Keep higher taxonomic ranks?

    n

    Number of sequences per taxon

    choose_by

    Vector of selection functions

    greatest

    Greatest of lowest for each choose_by function

    - -

    Value

    - -

    phylota

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_clstrs, - drop_sqs, get_clstr_slot, - get_nsqs, get_ntaxa, - get_sq_slot, get_stage_times, - get_tx_slot, get_txids, - is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -

    Examples

    - 
    data("dragonflies")
-# For faster computations, let's only work with the 5 clusters.
-dragonflies <- drop_clstrs(phylota = dragonflies, cid = dragonflies@cids[10:15])
-
-
-# We can use drop_by_rank() to reduce to 10 sequences per genus for each cluster
-(reduced_1 <- drop_by_rank(phylota = dragonflies, rnk = 'genus', n = 10,
-                           choose_by = c('pambgs', 'age', 'nncltds'),
-                           greatest = c(FALSE, FALSE, TRUE)))
    #> Phylota Table (Anisoptera)
-#> - [6] clusters
-#> - [175] sequences
-#> - [78] source taxa
    
-# We can specify what aspects of the sequences we would like to select per genus
-# By default we select the sequences with fewest ambiguous nucleotides (e.g.
-# we avoid Ns), the youngest age and then longest sequence.
-# We can reverse the 'greatest' to get the opposite.
-(reduced_2 <- drop_by_rank(phylota = dragonflies, rnk = 'genus', n = 10,
-                           choose_by = c('pambgs', 'age', 'nncltds'),
-                           greatest = c(TRUE, TRUE, FALSE)))
    #> Phylota Table (Anisoptera)
-#> - [6] clusters
-#> - [174] sequences
-#> - [89] source taxa
    
-
-# Leading to smaller sequnces ...
-r1_sqlngth <- mean(get_sq_slot(phylota = reduced_1,
-                                sid = reduced_1@sids, slt_nm = 'nncltds'))
-r2_sqlngth <- mean(get_sq_slot(phylota = reduced_2,
-                                sid = reduced_2@sids, slt_nm = 'nncltds'))
-(r1_sqlngth > r2_sqlngth)
    #> [1] FALSE
    # ... with more ambigous characters ....
-r1_pambgs <- mean(get_sq_slot(phylota = reduced_1, sid = reduced_1@sids,
-                              slt_nm = 'pambgs'))
-r2_pambgs <- mean(get_sq_slot(phylota = reduced_2, sid = reduced_2@sids,
-                              slt_nm = 'pambgs'))
-(r1_pambgs < r2_pambgs)
    #> [1] TRUE
    # .... and older ages (measured in days since being added to GenBank).
-r1_age <- mean(get_sq_slot(phylota = reduced_1, sid = reduced_1@sids,
-                           slt_nm = 'age'))
-r2_age <- mean(get_sq_slot(phylota = reduced_2, sid = reduced_2@sids,
-                           slt_nm = 'age'))
-(r1_age < r2_age)
    #> [1] FALSE
    
-
-# Or... we can simply reduce the clusters to just one sequence per genus
-(dragonflies <- drop_by_rank(phylota = dragonflies, rnk = 'genus', n = 1))
    #> Phylota Table (Anisoptera)
-#> - [6] clusters
-#> - [41] sequences
-#> - [37] source taxa
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/drop_cls.html b/docs/reference/drop_cls.html deleted file mode 100644 index ef4dea4..0000000 --- a/docs/reference/drop_cls.html +++ /dev/null @@ -1,196 +0,0 @@ - - - - - - - - -Drop cluster records from phylota object — drop_cls • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Drop cluster records from phylota object

    - Source: R/user-drop.R - -
    - -
    - -

    Drops all clusters except those -identified by user.

    - -
    - - 
    drop_cls(phylota, cid)
    - -

    Arguments

    - - - - - - - - - - -
    phylota

    Phylota object

    cid

    Cluster ID(s) to be kept

    - -

    Value

    - -

    phylota

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_sqs, get_clstr_slot, - get_nsqs, get_ntaxa, - get_sq_slot, get_tx_slot, - get_txids, is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_phylota, - write_sqs

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown.

    -
    - -
    -
    - - - - - - diff --git a/docs/reference/drop_clstrs.html b/docs/reference/drop_clstrs.html deleted file mode 100644 index 3f1bf23..0000000 --- a/docs/reference/drop_clstrs.html +++ /dev/null @@ -1,202 +0,0 @@ - - - - - - - - -Drop cluster records from phylota object — drop_clstrs • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Drop cluster records from phylota object

    - Source: R/user-drop.R - -
    - -
    - -

    Drops all clusters except those -identified by user.

    - -
    - - 
    drop_clstrs(phylota, cid)
    - -

    Arguments

    - - - - - - - - - - -
    phylota

    Phylota object

    cid

    Cluster ID(s) to be kept

    - -

    Value

    - -

    phylota

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_sqs, get_clstr_slot, - get_nsqs, get_ntaxa, - get_sq_slot, get_stage_times, - get_tx_slot, get_txids, - is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -

    Examples

    - 
    data("dragonflies")
-# specify cids to *keep*
-random_cids <- sample(dragonflies@cids, 100)
-# drop an entire cluster
-nbefore <- length(dragonflies@cids)
-dragonflies <- drop_clstrs(phylota = dragonflies, cid = random_cids)
-nafter <- length(dragonflies@cids)
-# now there are only 100 clusters
-(nafter < nbefore)
    #> [1] TRUE
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/drop_sqs.html b/docs/reference/drop_sqs.html deleted file mode 100644 index 2012a55..0000000 --- a/docs/reference/drop_sqs.html +++ /dev/null @@ -1,205 +0,0 @@ - - - - - - - - -Drop sequences in a cluster — drop_sqs • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Drop sequences in a cluster

    - Source: R/user-drop.R - -
    - -
    - -

    Drop all sequences in a cluster except those identified by user.

    - -
    - - 
    drop_sqs(phylota, cid, sid)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    phylota

    Phylota object

    cid

    Cluster ID

    sid

    Sequence ID(s) to be kept

    - -

    Value

    - -

    phylota

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_clstrs, get_clstr_slot, - get_nsqs, get_ntaxa, - get_sq_slot, get_stage_times, - get_tx_slot, get_txids, - is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -

    Examples

    - 
    data("dragonflies")
-# drop random sequences from cluster 0
-clstr <- dragonflies[['0']]
-# specify the sids to *keep*
-sids <- sample(clstr@sids, 100)
-(dragonflies <- drop_sqs(phylota = dragonflies, cid = '0', sid = sids))
    #> Phylota Table (Anisoptera)
-#> - [784] clusters
-#> - [10617] sequences
-#> - [1143] source taxa
    # Note, sequences dropped may be represented in other clusters
-
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/error.html b/docs/reference/error.html deleted file mode 100644 index 8260d15..0000000 --- a/docs/reference/error.html +++ /dev/null @@ -1,210 +0,0 @@ - - - - - - - - -Write error message to log — error • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Write error message to log

    - Source: R/tools-log.R - -
    - -
    - -

    Inform a user if an error has occurred in log.txt, -halt pipeline.

    - -
    - - 
    error(ps, ...)
    - -

    Arguments

    - - - - - - - - - - -
    ps

    Parameters list, generated with parameters()

    ...

    Message elements for concatenating

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/gb_extract.html b/docs/reference/gb_extract.html deleted file mode 100644 index 080ccba..0000000 --- a/docs/reference/gb_extract.html +++ /dev/null @@ -1,217 +0,0 @@ - - - - - - - - -Extract elements from a raw GenBank record — gb_extract • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Extract elements from a raw GenBank record

    - Source: R/tools-sqs.R - -
    - -
    - -

    Returns a list of elements from a GenBank record such as -'organism', 'sequence' and features.

    - -
    - - 
    gb_extract(record)
    - -

    Arguments

    - - - - - - -
    record

    raw GenBank text record

    - -

    Value

    - -

    list of GenBank elements

    - -

    Details

    - -

    Uses restez extract functions. See restez package for more details.

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/get_clstr_slot.html b/docs/reference/get_clstr_slot.html deleted file mode 100644 index 36ad90c..0000000 --- a/docs/reference/get_clstr_slot.html +++ /dev/null @@ -1,200 +0,0 @@ - - - - - - - - -Get slot data for each cluster record — get_clstr_slot • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Get slot data for each cluster record

    - Source: R/user-get.R - -
    - -
    - -

    Get slot data for cluster(s)

    - -
    - - 
    get_clstr_slot(phylota, cid, slt_nm = list_clstrrec_slots())
    - -

    Arguments

    - - - - - - - - - - - - - - -
    phylota

    Phylota object

    cid

    Cluster ID

    slt_nm

    Slot name

    - -

    Value

    - -

    vector

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_clstrs, drop_sqs, - get_nsqs, get_ntaxa, - get_sq_slot, get_stage_times, - get_tx_slot, get_txids, - is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -

    Examples

    - 
    data('aotus')
-random_cid <- sample(aotus@cids, 1)
-(get_clstr_slot(phylota = aotus, cid = random_cid, slt_nm = 'seed'))
    #>           80 
-#> "HM764901.1" 
    # see list_clstrrec_slots() for available slots
-(list_clstrrec_slots())
    #> [1] "id"   "nsqs" "ntx"  "typ"  "prnt" "seed"
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/get_nsqs.html b/docs/reference/get_nsqs.html deleted file mode 100644 index 6dcb27e..0000000 --- a/docs/reference/get_nsqs.html +++ /dev/null @@ -1,195 +0,0 @@ - - - - - - - - -Count number of sequences — get_nsqs • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Count number of sequences

    - Source: R/user-get.R - -
    - -
    - -

    Count the number of sequences in a cluster(s).

    - -
    - - 
    get_nsqs(phylota, cid)
    - -

    Arguments

    - - - - - - - - - - -
    phylota

    Phylota object

    cid

    Cluster ID(s)

    - -

    Value

    - -

    vector

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_clstrs, drop_sqs, - get_clstr_slot, get_ntaxa, - get_sq_slot, get_stage_times, - get_tx_slot, get_txids, - is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -

    Examples

    - 
    data("cycads")
-# count seqs for a random 10 clusters
-random_cids <- sample(cycads@cids, 10)
-nsqs <- get_nsqs(phylota = cycads, cid = random_cids)
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/get_ntaxa.html b/docs/reference/get_ntaxa.html deleted file mode 100644 index d2643ce..0000000 --- a/docs/reference/get_ntaxa.html +++ /dev/null @@ -1,219 +0,0 @@ - - - - - - - - -Count number of unique taxa — get_ntaxa • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Count number of unique taxa

    - Source: R/user-get.R - -
    - -
    - -

    Count the number of unique taxa represented by cluster(s) or -sequences in phylota table Use rnk to specify a taxonomic level to count. If -NULL counts will be made to the lowest level reported on NCBI.

    - -
    - - 
    get_ntaxa(phylota, cid = NULL, sid = NULL, rnk = NULL,
-  keep_higher = FALSE)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - -
    phylota

    Phylota object

    cid

    Cluster ID(s)

    sid

    Sequence ID(s)

    rnk

    Taxonomic rank

    keep_higher

    Keep higher taxonomic ranks?

    - -

    Value

    - -

    vector

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_clstrs, drop_sqs, - get_clstr_slot, get_nsqs, - get_sq_slot, get_stage_times, - get_tx_slot, get_txids, - is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -

    Examples

    - 
    data('bromeliads')
-# how many species are there?
-(get_ntaxa(phylota = bromeliads, cid = '0', rnk = 'species'))
    #>   0 
-#> 891 
    # how many genera are there?
-(get_ntaxa(phylota = bromeliads, cid = '0', rnk = 'genus'))
    #>  0 
-#> 65 
    # how many families are there?
-(get_ntaxa(phylota = bromeliads, cid = '0', rnk = 'family'))
    #> 0 
-#> 1 
    # use list_ncbi_ranks() to see available rank names
-(list_ncbi_ranks())
    #>  [1] "superkingdom" "kingdom"      "phylum"       "subphylum"    "class"       
-#>  [6] "superorder"   "order"        "suborder"     "infraorder"   "parvorder"   
-#> [11] "family"       "genus"        "species"      "subspecies"
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/get_sq_slot.html b/docs/reference/get_sq_slot.html deleted file mode 100644 index e4dee1f..0000000 --- a/docs/reference/get_sq_slot.html +++ /dev/null @@ -1,211 +0,0 @@ - - - - - - - - -Get slot data for each sequence — get_sq_slot • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Get slot data for each sequence

    - Source: R/user-get.R - -
    - -
    - -

    Get slot data for either or sequences in a cluster of -a vector of sequence IDs. Use list_seqrec_slots() for a list of -available slots.

    - -
    - - 
    get_sq_slot(phylota, cid = NULL, sid = NULL,
-  slt_nm = list_seqrec_slots())
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - -
    phylota

    Phylota object

    cid

    Cluster ID

    sid

    Sequence ID(s)

    slt_nm

    Slot name

    - -

    Value

    - -

    vector

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_clstrs, drop_sqs, - get_clstr_slot, get_nsqs, - get_ntaxa, get_stage_times, - get_tx_slot, get_txids, - is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -

    Examples

    - 
    data('aotus')
-random_sid <- sample(aotus@sids, 1)
-(get_sq_slot(phylota = aotus, sid = random_sid, slt_nm = 'dfln'))
    #>                                                   HM762858.1 
-#> "Aotus nancymaae isolate ANA-1 DACH1 gene, partial sequence" 
    # see list_seqrec_slots() for available slots
-(list_seqrec_slots())
    #>  [1] "id"      "nm"      "accssn"  "vrsn"    "url"     "txid"    "orgnsm" 
-#>  [8] "dfln"    "ml_typ"  "rec_typ" "nncltds" "nambgs"  "pambgs"  "gcr"    
-#> [15] "age"
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/get_stage_times.html b/docs/reference/get_stage_times.html deleted file mode 100644 index 15aa117..0000000 --- a/docs/reference/get_stage_times.html +++ /dev/null @@ -1,193 +0,0 @@ - - - - - - - - -Get run times for different stages — get_stage_times • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Get run times for different stages

    - Source: R/user-get.R - -
    - -
    - -

    Get slot data for taxa(s)

    - -
    - - 
    get_stage_times(wd)
    - -

    Arguments

    - - - - - - -
    wd

    Working directory

    - -

    Value

    - -

    list of runtimes in minutes

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_clstrs, drop_sqs, - get_clstr_slot, get_nsqs, - get_ntaxa, get_sq_slot, - get_tx_slot, get_txids, - is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -

    Examples

    - 
    # NOT RUN {
-
-  # Note, this example requires a wd with a completed phylotaR run
-  # return a named list of the time take in minutes for each stage
-  get_stage_times(wd = wd)
-# }
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/get_tx_slot.html b/docs/reference/get_tx_slot.html deleted file mode 100644 index 0c010a3..0000000 --- a/docs/reference/get_tx_slot.html +++ /dev/null @@ -1,200 +0,0 @@ - - - - - - - - -Get slot data for each taxon record — get_tx_slot • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Get slot data for each taxon record

    - Source: R/user-get.R - -
    - -
    - -

    Get slot data for taxa(s)

    - -
    - - 
    get_tx_slot(phylota, txid, slt_nm = list_taxrec_slots())
    - -

    Arguments

    - - - - - - - - - - - - - - -
    phylota

    Phylota object

    txid

    Taxonomic ID

    slt_nm

    Slot name

    - -

    Value

    - -

    vector or list

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_clstrs, drop_sqs, - get_clstr_slot, get_nsqs, - get_ntaxa, get_sq_slot, - get_stage_times, get_txids, - is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -

    Examples

    - 
    data('aotus')
-random_txid <- sample(aotus@txids, 1)
-(get_tx_slot(phylota = aotus, txid = random_txid, slt_nm = 'scnm'))
    #>                   867331 
-#> "Aotus azarai infulatus" 
    # see list_taxrec_slots() for available slots
-(list_taxrec_slots())
    #> [1] "id"   "scnm" "cmnm" "rnk"  "prnt"
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/get_txids.html b/docs/reference/get_txids.html deleted file mode 100644 index d0bc121..0000000 --- a/docs/reference/get_txids.html +++ /dev/null @@ -1,263 +0,0 @@ - - - - - - - - -Get taxonomic IDs by rank — get_txids • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Get taxonomic IDs by rank

    - Source: R/user-get.R - -
    - -
    - -

    Return taxonomic IDs for a vector of sequence IDs or all -sequences in a cluster. User can specify what rank the IDs should be -returned. If NULL, the lowest level is returned.

    - -
    - - 
    get_txids(phylota, cid = NULL, sid = NULL, txids = NULL,
-  rnk = NULL, keep_higher = FALSE)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - - - - - -
    phylota

    Phylota object

    cid

    Cluster ID

    sid

    Sequence ID(s)

    txids

    Vector of txids

    rnk

    Taxonomic rank

    keep_higher

    Keep higher taxonomic IDs?

    - -

    Value

    - -

    vector

    - -

    Details

    - -

    txids can either be provided by user or they can be determined for -a vector of sids or for a cid. If keep_higher is TRUE, any sequence that has -a identity that is higher than the given rank will be returned. If FALSE, -these sequences will return ''.

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_clstrs, drop_sqs, - get_clstr_slot, get_nsqs, - get_ntaxa, get_sq_slot, - get_stage_times, get_tx_slot, - is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -

    Examples

    - 
    data('bromeliads')
-# get all the genus IDs and names
-genus_ids <- get_txids(phylota = bromeliads, txids = bromeliads@txids,
-                       rnk = 'genus')
-genus_ids <- unique(genus_ids)
-# drop empty IDs -- this happens if a given lineage has no ID for specified rank
-genus_ids <- genus_ids[genus_ids != '']
-# get names
-(get_tx_slot(phylota = bromeliads, txid = genus_ids, slt_nm = 'scnm'))
    #>              100680             2184933             2184932             2184931 
-#>      "Cottendorfia"         "Sincoraea"       "Rokautskyia"  "Hoplocryptanthus" 
-#>             1387303             1349361              796805              713961 
-#>         "Lapanthus"      "Canistropsis"      "Disteganthus"         "Eduandrea" 
-#>              326799              326795              326788              213064 
-#>            "Portea"   "Hohenbergiopsis"          "Fernseea"          "Edmundoa" 
-#>              106462              106458              106452              106447 
-#>         "Ochagavia"      "Neoglaziovia"           "Greigia"      "Fascicularia" 
-#>              106440              106438              106430              106424 
-#>      "Deinacanthon"        "Chevaliera"        "Androlepis"    "Acanthostachys" 
-#>               49536               49531               49529               49522 
-#>        "Wittrockia"        "Ronnbergia"         "Quesnelia"       "Orthophytum" 
-#>               49520               49512               49496               49493 
-#>        "Nidularium"           "Lymania"       "Cryptanthus"         "Canistrum" 
-#>               49491               49476               15119               15114 
-#>       "Hohenbergia"       "Araeococcus"        "Billbergia"           "Aechmea" 
-#>                4616                4614               15164               49487 
-#>          "Bromelia"            "Ananas"              "Puya"        "Fosterella" 
-#>               49526               49485               49483              100682 
-#>        "Pitcairnia"       "Encholirium"            "Dyckia"     "Deuterocohnia" 
-#>               49516              222987               15141              261216 
-#>             "Navia"         "Brewcaria"           "Hechtia"         "Lindmania" 
-#>              106432               49479              106428              213045 
-#>           "Ayensua"        "Brocchinia"        "Alcantarea"          "Werauhia" 
-#>             1908698               49518               49534             1908703 
-#>           "Goudaea"        "Neoregelia"           "Vriesea"          "Lutheria" 
-#>               49514             1908700             2002971             1908705 
-#>      "Mezobromelia"         "Jagrantia"         "Waltillia"       "Stigmatodon" 
-#>             1908701             1908706               15170              106471 
-#>         "Josemania"           "Zizkaea"        "Tillandsia"          "Racinaea" 
-#>             1908553             1908702             1908697             1908704 
-#>          "Wallisia"        "Lemeltonia"         "Barfussia"   "Pseudalcantarea" 
-#>               49489             1908699               15123               15137 
-#>          "Guzmania"       "Gregbrownia"          "Catopsis" "Glomeropitcairnia"
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/hierarchic_download.html b/docs/reference/hierarchic_download.html deleted file mode 100644 index 133a4cb..0000000 --- a/docs/reference/hierarchic_download.html +++ /dev/null @@ -1,222 +0,0 @@ - - - - - - - - -Hierarchically get sequences for a txid — hierarchic_download • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Hierarchically get sequences for a txid

    - Source: R/stage2-tools.R - -
    - -
    - -

    Looks up and downloads sequences for a taxonomic ID.

    - -
    - - 
    hierarchic_download(txid, txdct, ps, lvl = 0)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - -
    txid

    Taxonomic node ID, numeric

    txdct

    Taxonomic dictionary

    ps

    Parameters list, generated with parameters()

    lvl

    Integer, number of message indentations indicating code -depth.

    - -

    Value

    - -

    Vector of SeqRecs

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/index.html b/docs/reference/index.html deleted file mode 100644 index 8cc794e..0000000 --- a/docs/reference/index.html +++ /dev/null @@ -1,953 +0,0 @@ - - - - - - - - -Function reference • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Reference

    -
    - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -

    Running

    -

    Functions for starting/stopping the phylotaR pipeline.

    -
    -

    setup()

    -

    Set-up parameters

    -

    run()

    -

    Run phylotaR pipeline

    -

    restart()

    -

    Restart a phylotaR pipeline run

    -

    reset()

    -

    Reset a phylotaR pipeline run

    -

    parameters()

    -

    Default parameters

    -

    parameters_reset()

    -

    Change parameters in a working directory

    -

    taxise_run()

    -

    Run taxise stage

    -

    download_run()

    -

    Run download stage

    -

    clusters_run()

    -

    Run the cluster stage

    -

    clusters2_run()

    -

    Run the cluster2 stage

    -

    Tools

    -

    Tools for interacting with the Phylota object

    -
    -

    read_phylota()

    -

    Generate a Phylota object in R

    -

    drop_by_rank()

    -

    Reduce clusters to specific rank

    -

    drop_clstrs()

    -

    Drop cluster records from phylota object

    -

    drop_sqs()

    -

    Drop sequences in a cluster

    -

    get_clstr_slot()

    -

    Get slot data for each cluster record

    -

    get_sq_slot()

    -

    Get slot data for each sequence

    -

    get_tx_slot()

    -

    Get slot data for each taxon record

    -

    get_nsqs()

    -

    Count number of sequences

    -

    get_ntaxa()

    -

    Count number of unique taxa

    -

    get_txids()

    -

    Get taxonomic IDs by rank

    -

    is_txid_in_clstr()

    -

    Is txid in cluster?

    -

    is_txid_in_sq()

    -

    Is txid in sequence?

    -

    list_clstrrec_slots()

    -

    List all ClstrRec slots

    -

    list_ncbi_ranks()

    -

    List all NCBI Ranks

    -

    list_seqrec_slots()

    -

    List all SeqRec slots

    -

    list_taxrec_slots()

    -

    List all TaxRec slots

    -

    calc_wrdfrq()

    -

    Calculate word frequencies

    -

    calc_mad()

    -

    Calculate MAD score

    -

    write_sqs()

    -

    Write out sequences

    -

    plot_phylota_treemap()

    -

    Plot treemap of Phylota object

    -

    plot_phylota_pa()

    -

    Plot presence/absence matrix

    -

    get_stage_times()

    -

    Get run times for different stages

    -

    Data

    -

    Example Phylota objects

    -
    -

    aotus

    -

    Example phylota object (aotus)

    -

    bromeliads

    -

    Example phylota object (bromeliads)

    -

    cycads

    -

    Example phylota object (cycads)

    -

    dragonflies

    -

    Example phylota object (dragonflies)

    -

    sturgeons

    -

    Example phylota object (sturgeons)

    -

    tardigrades

    -

    Example phylota object (tardigrades)

    -

    tinamous

    -

    Example phylota object (tinamous)

    -

    yeasts

    -

    Example phylota object (yeasts)

    -

    Classes

    -

    S4 classes

    -
    -

    as.character(<ClstrArc>) show(<ClstrArc>) print(<ClstrArc>) str(<ClstrArc>) summary(<ClstrArc>) `[[`(<ClstrArc>,<character>) `[`(<ClstrArc>,<character>,<missing>,<missing>)

    -

    Cluster record archive

    -

    as.character(<ClstrRec>) show(<ClstrRec>) print(<ClstrRec>) str(<ClstrRec>) summary(<ClstrRec>)

    -

    Cluster record

    -

    as.character(<Phylota>) show(<Phylota>) print(<Phylota>) str(<Phylota>) summary(<Phylota>) `[[`(<Phylota>,<character>)

    -

    Phylota object

    -

    as.character(<SeqArc>) show(<SeqArc>) print(<SeqArc>) str(<SeqArc>) summary(<SeqArc>) `[[`(<SeqArc>,<character>) `[`(<SeqArc>,<character>,<missing>,<missing>)

    -

    Sequence record archive

    -

    as.character(<SeqRec>) show(<SeqRec>) print(<SeqRec>) str(<SeqRec>) summary(<SeqRec>)

    -

    Sequence record

    -

    as.character(<TaxDict>) show(<TaxDict>) print(<TaxDict>) str(<TaxDict>) summary(<TaxDict>)

    -

    Taxonomic record dictionary

    -

    as.character(<TaxRec>) show(<TaxRec>) print(<TaxRec>) str(<TaxRec>) summary(<TaxRec>)

    -

    Taxonomic record

    -

    Taxise (private)

    -

    Internal functions for running the taxise stage, use phylotaR::: to access.

    -
    -

    rank_get()

    -

    Get rank

    -

    descendants_get()

    -

    Get descendants

    -

    sqs_count()

    -

    Count number of sequences for txid

    -

    clade_select()

    -

    Get all node IDs that will be processed

    -

    txnds_count()

    -

    Count number of descending taxonomic nodes

    -

    txids_get()

    -

    Searches for descendant taxonomic IDs

    -

    parent_get()

    -

    Get taxonomic parent

    -

    tax_download()

    -

    Download taxonomic records

    -

    taxdict_gen()

    -

    Generate taxonomic dictionary

    -

    taxtree_gen()

    -

    Generate taxonomic tree

    -

    Download (private)

    -

    Internal functions for running the download stage, use phylotaR::: to access.

    -
    -

    searchterm_gen()

    -

    Construct GenBank Search Term

    -

    seq_download()

    -

    Download sequences for txids

    -

    seqarc_gen()

    -

    Generate sequence archive

    -

    seqrec_augment()

    -

    Augment sequence records list

    -

    seqrec_convert()

    -

    Convert raw Entrez gb text record to SeqRecs

    -

    seqrec_gen()

    -

    Generate sequence record

    -

    seqrec_get()

    -

    seqrec_get

    -

    hierarchic_download()

    -

    Hierarchically get sequences for a txid

    -

    sids_get()

    -

    Return random set of sequence IDs

    -

    Cluster (private)

    -

    Internal functions for running the cluster stage, use phylotaR::: to access.

    -
    -

    blast_clstr()

    -

    Cluster BLAST Results

    -

    blast_filter()

    -

    Filter BLAST results

    -

    blast_sqs()

    -

    BLAST All vs All

    -

    blastdb_gen()

    -

    Generate a BLAST database

    -

    blastn_run()

    -

    Launch blastn

    -

    clstr_all()

    -

    Hierarchically cluster all sequences of a txid

    -

    clstr_direct()

    -

    Cluster sequences directly associated with txid

    -

    clstr_sqs()

    -

    Identify clusters from sequences

    -

    clstr_subtree()

    -

    Cluster all sequences descending from a txid

    -

    clstrarc_gen()

    -

    Generate cluster archive container class

    -

    clstrarc_join()

    -

    Join two cluster archive

    -

    clstrrec_gen()

    -

    Generate list of clusters

    -

    clstrs_calc()

    -

    Calculate clusters for all sequences in wd

    -

    Cluster2 (private)

    -

    Internal functions for running the cluster2 stage, use phylotaR::: to access.

    -
    -

    seeds_blast()

    -

    BLAST seed sequences

    -

    clstr2_calc()

    -

    Cluster sets of clusters identified in cluster stage

    -

    clstrs_join()

    -

    Join clusters for merging

    -

    clstrs_merge()

    -

    Merge joined clusters

    -

    clstrs_renumber()

    -

    Renumber cluster IDs

    -

    Misc (private)

    -

    Miscellaneous internal functions, use phylotaR::: to access.

    -
    -

    blast_setup()

    -

    Ensures NCBI BLAST tools are installed

    -

    download_obj_check()

    -

    Check an object returned from rentrez function

    -

    safely_connect()

    -

    Safely run rentrez function

    -

    search_and_cache()

    -

    Run rentrez function and cache results

    -

    batcher()

    -

    Download in batches

    -

    info()

    -

    Write info message to log

    -

    error()

    -

    Write error message to log

    -

    warn()

    -

    Write warning message to log

    -

    blastcache_load()

    -

    Load BLAST results from cache

    -

    blastcache_save()

    -

    Save BLAST results to cache

    -

    sids_check()

    -

    Check if sids exist

    -

    sids_load()

    -

    Load sids from cache

    -

    sids_save()

    -

    Save sids to cache

    -

    cache_rm()

    -

    Delete a cache

    -

    cache_setup()

    -

    Set-up a cache

    -

    sqs_save()

    -

    Save sequences to cache

    -

    ncbicache_load()

    -

    Retrieve cached NCBI query

    -

    ncbicache_save()

    -

    Save NCBI query result to cache

    -

    stages_run()

    -

    Sequentially run each stage

    -

    stage_args_check()

    -

    Check stage arguments

    -

    mk_txid_in_sq_mtrx()

    -

    Return matrix of txid in sequence

    -

    obj_check()

    -

    Check if an object exists

    -

    obj_load()

    -

    Load a named object from the cache

    -

    obj_save()

    -

    Save a named object in the cache

    -

    summary_phylota()

    -

    Summarise clusters in Phylota Table

    -

    parameters_load()

    -

    Load parameters from cache

    -

    progress_init()

    -

    Initialise progress list in cache

    -

    progress_read()

    -

    Read the progress from cache

    -

    progress_reset()

    -

    Reset progress

    -

    progress_save()

    -

    Save current progress

    -

    cmdln()

    -

    Run a command via terminal/command prompt

    -

    update_phylota()

    -

    Update slots

    -

    parameters_setup()

    -

    Set Up Parameters

    -

    clstrs_save()

    -

    Save clusters to cache

    -

    gb_extract()

    -

    Extract elements from a raw GenBank record

    -

    rawseqrec_breakdown()

    -

    Breakdown a sequence record into its features

    -
    - - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/info.html b/docs/reference/info.html deleted file mode 100644 index e6ab09b..0000000 --- a/docs/reference/info.html +++ /dev/null @@ -1,213 +0,0 @@ - - - - - - - - -Write info message to log — info • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Write info message to log

    - Source: R/tools-log.R - -
    - -
    - -

    Inform a user via log.txt of pipeline progress.

    - -
    - - 
    info(lvl, ps, ...)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    lvl

    Integer, number of message indentations indicating code -depth.

    ps

    Parameters list, generated with parameters()

    ...

    Message elements for concatenating

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/is_txid_in_clstr.html b/docs/reference/is_txid_in_clstr.html deleted file mode 100644 index 90297e3..0000000 --- a/docs/reference/is_txid_in_clstr.html +++ /dev/null @@ -1,205 +0,0 @@ - - - - - - - - -Is txid in cluster? — is_txid_in_clstr • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Is txid in cluster?

    - Source: R/user-special.R - -
    - -
    - -

    Checks if given txid is represented by any of the -sequences of a cluster by searching through all the sequence search -organism lineages.

    - -
    - - 
    is_txid_in_clstr(phylota, txid, cid)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    phylota

    Phylota

    txid

    Taxonomic ID

    cid

    Cluster ID

    - -

    Value

    - -

    boolean

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_clstrs, drop_sqs, - get_clstr_slot, get_nsqs, - get_ntaxa, get_sq_slot, - get_stage_times, get_tx_slot, - get_txids, is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -

    Examples

    - 
    data(tinamous)
-cid <- tinamous@cids[[1]]
-clstr <- tinamous[[cid]]
-sq <- tinamous[[clstr@sids[[1]]]]
-txid <- sq@txid
-# expect true
-is_txid_in_clstr(phylota = tinamous, txid = txid, cid = cid)
    #> [1] TRUE
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/is_txid_in_sq.html b/docs/reference/is_txid_in_sq.html deleted file mode 100644 index d511178..0000000 --- a/docs/reference/is_txid_in_sq.html +++ /dev/null @@ -1,202 +0,0 @@ - - - - - - - - -Is txid in sequence? — is_txid_in_sq • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Is txid in sequence?

    - Source: R/user-special.R - -
    - -
    - -

    Checks if given txid is represented by sequence by -looking at sequence source organism's lineage.

    - -
    - - 
    is_txid_in_sq(phylota, txid, sid)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    phylota

    Phylota

    txid

    Taxonomic ID

    sid

    Sequence ID

    - -

    Value

    - -

    boolean

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_clstrs, drop_sqs, - get_clstr_slot, get_nsqs, - get_ntaxa, get_sq_slot, - get_stage_times, get_tx_slot, - get_txids, is_txid_in_clstr, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -

    Examples

    - 
    data(tinamous)
-sid <- tinamous@sids[[1]]
-sq <- tinamous[[sid]]
-txid <- sq@txid
-# expect true
-is_txid_in_sq(phylota = tinamous, txid = txid, sid = sid)
    #> [1] TRUE
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/list_clstrrec_slots.html b/docs/reference/list_clstrrec_slots.html deleted file mode 100644 index 04745d6..0000000 --- a/docs/reference/list_clstrrec_slots.html +++ /dev/null @@ -1,175 +0,0 @@ - - - - - - - - -List all ClstrRec slots — list_clstrrec_slots • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    List all ClstrRec slots

    - Source: R/phylotaR.R - -
    - -
    - -

    Returns a vector of all available ClstrRec slots of type -character, integer and numeric.

    - -
    - - 
    list_clstrrec_slots()
    - -

    Value

    - -

    vector

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_clstrs, drop_sqs, - get_clstr_slot, get_nsqs, - get_ntaxa, get_sq_slot, - get_stage_times, get_tx_slot, - get_txids, is_txid_in_clstr, - is_txid_in_sq, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/list_ncbi_ranks.html b/docs/reference/list_ncbi_ranks.html deleted file mode 100644 index e5842c4..0000000 --- a/docs/reference/list_ncbi_ranks.html +++ /dev/null @@ -1,175 +0,0 @@ - - - - - - - - -List all NCBI Ranks — list_ncbi_ranks • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    List all NCBI Ranks

    - Source: R/phylotaR.R - -
    - -
    - -

    Returns a vector of all -NCBI taxonomic ranks in descending order.

    - -
    - - 
    list_ncbi_ranks()
    - -

    Value

    - -

    vector

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_clstrs, drop_sqs, - get_clstr_slot, get_nsqs, - get_ntaxa, get_sq_slot, - get_stage_times, get_tx_slot, - get_txids, is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/list_seqrec_slots.html b/docs/reference/list_seqrec_slots.html deleted file mode 100644 index b3347da..0000000 --- a/docs/reference/list_seqrec_slots.html +++ /dev/null @@ -1,175 +0,0 @@ - - - - - - - - -List all SeqRec slots — list_seqrec_slots • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    List all SeqRec slots

    - Source: R/phylotaR.R - -
    - -
    - -

    Returns a vector of all available SeqRec slots of type -character, integer and numeric.

    - -
    - - 
    list_seqrec_slots()
    - -

    Value

    - -

    vector

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_clstrs, drop_sqs, - get_clstr_slot, get_nsqs, - get_ntaxa, get_sq_slot, - get_stage_times, get_tx_slot, - get_txids, is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/list_taxrec_slots.html b/docs/reference/list_taxrec_slots.html deleted file mode 100644 index dd2c9b5..0000000 --- a/docs/reference/list_taxrec_slots.html +++ /dev/null @@ -1,175 +0,0 @@ - - - - - - - - -List all TaxRec slots — list_taxrec_slots • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    List all TaxRec slots

    - Source: R/phylotaR.R - -
    - -
    - -

    Returns a vector of all available TaxRec slots of type -character, integer and numeric.

    - -
    - - 
    list_taxrec_slots()
    - -

    Value

    - -

    vector

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_clstrs, drop_sqs, - get_clstr_slot, get_nsqs, - get_ntaxa, get_sq_slot, - get_stage_times, get_tx_slot, - get_txids, is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/mk_txid_in_sq_mtrx.html b/docs/reference/mk_txid_in_sq_mtrx.html deleted file mode 100644 index 8fb1fdc..0000000 --- a/docs/reference/mk_txid_in_sq_mtrx.html +++ /dev/null @@ -1,181 +0,0 @@ - - - - - - - - -Return matrix of txid in sequence — mk_txid_in_sq_mtrx • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Return matrix of txid in sequence

    - Source: R/user-special.R - -
    - -
    - -

    Searches through lineages of sequences' source organisms to -determine whether each txid is represented by the sequence.

    - -
    - - 
    mk_txid_in_sq_mtrx(phylota, txids, sids = phylota@sids)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    phylota

    Phylota

    txids

    Taxonomic IDs

    sids

    Sequence IDs

    - -

    Value

    - -

    matrix

    - -

    See also

    - -

    Other tools-private: summary_phylota, - update_phylota

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/ncbicache_load.html b/docs/reference/ncbicache_load.html deleted file mode 100644 index f532caa..0000000 --- a/docs/reference/ncbicache_load.html +++ /dev/null @@ -1,217 +0,0 @@ - - - - - - - - -Retrieve cached NCBI query — ncbicache_load • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Retrieve cached NCBI query

    - Source: R/tools-cache.R - -
    - -
    - -

    Run this function to load cached NCBI queries.

    - -
    - - 
    ncbicache_load(fnm, args, wd)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    fnm

    NCBI Entrez function name

    args

    Args used for function

    wd

    Working directory

    - -

    Value

    - -

    rentrez result

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/ncbicache_save.html b/docs/reference/ncbicache_save.html deleted file mode 100644 index d90181b..0000000 --- a/docs/reference/ncbicache_save.html +++ /dev/null @@ -1,217 +0,0 @@ - - - - - - - - -Save NCBI query result to cache — ncbicache_save • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Save NCBI query result to cache

    - Source: R/tools-cache.R - -
    - -
    - -

    Run whenever NCBI queries are made to save results in -cache in case the pipeline is run again.

    - -
    - - 
    ncbicache_save(fnm, args, wd, obj)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - -
    fnm

    NCBI Entrez function name

    args

    Args used for function

    wd

    Working directory

    obj

    NCBI query result

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/obj_check.html b/docs/reference/obj_check.html deleted file mode 100644 index 184ddeb..0000000 --- a/docs/reference/obj_check.html +++ /dev/null @@ -1,213 +0,0 @@ - - - - - - - - -Check if an object exists — obj_check • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Check if an object exists

    - Source: R/tools-cache.R - -
    - -
    - -

    Check if an object exists in the cache.

    - -
    - - 
    obj_check(wd, nm)
    - -

    Arguments

    - - - - - - - - - - -
    wd

    Working directory

    nm

    Object name

    - -

    Value

    - -

    T/F

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_load, - obj_save, parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/obj_load.html b/docs/reference/obj_load.html deleted file mode 100644 index 0e821b6..0000000 --- a/docs/reference/obj_load.html +++ /dev/null @@ -1,215 +0,0 @@ - - - - - - - - -Load a named object from the cache — obj_load • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Load a named object from the cache

    - Source: R/tools-cache.R - -
    - -
    - -

    Loads an object from the cache as stored by -obj_save.

    - -
    - - 
    obj_load(wd, nm)
    - -

    Arguments

    - - - - - - - - - - -
    wd

    Working directory

    nm

    Object name

    - -

    Value

    - -

    object, multiple formats possible

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_save, parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/obj_save.html b/docs/reference/obj_save.html deleted file mode 100644 index 9bdb608..0000000 --- a/docs/reference/obj_save.html +++ /dev/null @@ -1,213 +0,0 @@ - - - - - - - - -Save a named object in the cache — obj_save • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Save a named object in the cache

    - Source: R/tools-cache.R - -
    - -
    - -

    Save an object in the cache that can be loaded by -obj_load.

    - -
    - - 
    obj_save(wd, obj, nm)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    wd

    Working directory

    obj

    Object

    nm

    Object name

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/parameters.html b/docs/reference/parameters.html deleted file mode 100644 index de4b501..0000000 --- a/docs/reference/parameters.html +++ /dev/null @@ -1,245 +0,0 @@ - - - - - - - - -Default parameters — parameters • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Default parameters

    - Source: R/phylotaR.R - -
    - -
    - -

    Returns a parameter list with default parameter values.

    - -
    - - 
    parameters(wd = ".", txid = character(), mkblstdb = "", blstn = "",
-  v = FALSE, ncps = 1, mxnds = 1e+05, mdlthrs = 3000,
-  mnsql = 250, mxsql = 2000, mxrtry = 100, mxsqs = 50000,
-  mxevl = 1e-10, mncvrg = 51, btchsz = 100, date = Sys.Date())
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    wd

    The working directory where all output files are saved.

    txid

    Taxonomic group of interest, allows vectors.

    mkblstdb

    File path to makeblastdb

    blstn

    File path to blastn

    v

    Print progress statements to console? -Statements will always be printed to log.txt.

    ncps

    The number of threads to use in the local-alignment search tool.

    mxnds

    The maximum number of nodes descending from a taxonomic group. -If there are more than this number, nodes at the lower taxonomic level are -analysed.

    mdlthrs

    'Model organism threshold'. Taxa with more sequences than this -number will be considered model organisms and a random mdlthrs subset of -their sequences will be downloaded.

    mnsql

    The minimum length of sequence in nucleotide base pairs to -download.

    mxsql

    The maximum length of sequence in nucleotide base pairs to -download. Any longer sequences will be ignored.

    mxrtry

    The maximum number of attempts to make when downloading.

    mxsqs

    The maximum number of sequences to BLAST in all-vs-all searches. -If there are more sequences for a node, BLAST is performed at the lower -taxonomic level.

    mxevl

    The maximum E-value for a successful BLAST.

    mncvrg

    The maximum percentile coverage defining an overlapping BLAST hit. -Sequences with BLAST matches with lower values are not considered orthologous.

    btchsz

    Batch size when querying NCBI

    date

    Date when pipeline was initiated

    - -

    Value

    - -

    list

    - -

    Details

    - -

    This function is NOT used to change the parameters in a folder. -Use parameters_reset() instead. The purpose of this function is to describe -the paramaters and present their default values.

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/parameters_load.html b/docs/reference/parameters_load.html deleted file mode 100644 index 50d0f72..0000000 --- a/docs/reference/parameters_load.html +++ /dev/null @@ -1,211 +0,0 @@ - - - - - - - - -Load parameters from cache — parameters_load • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Load parameters from cache

    - Source: R/tools-cache.R - -
    - -
    - -

    Parameters are held in cache, use this function to -load parameters set for a wd.

    - -
    - - 
    parameters_load(wd)
    - -

    Arguments

    - - - - - - -
    wd

    Working directory

    - -

    Value

    - -

    Parameters list

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/parameters_reset.html b/docs/reference/parameters_reset.html deleted file mode 100644 index 9b8e000..0000000 --- a/docs/reference/parameters_reset.html +++ /dev/null @@ -1,204 +0,0 @@ - - - - - - - - -Change parameters in a working directory — parameters_reset • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Change parameters in a working directory

    - Source: R/pipeline.R - -
    - -
    - -

    Reset parameters after running setup().

    - -
    - - 
    parameters_reset(wd, parameters, values)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    wd

    Working directory

    parameters

    Parameters to be changed, vector.

    values

    New values for each parameter, vector.

    - -

    See also

    - -

    Other run-public: ClstrArc-class, - ClstrRec-class, - Phylota-class, SeqArc-class, - SeqRec-class, TaxDict-class, - TaxRec-class, clusters2_run, - clusters_run, reset, - restart, run, - setup, taxise_run

    - - -

    Examples

    - 
    # NOT RUN {
-
-  # Note: this example requires BLAST and internet to run.
-
-  # example with temp folder
-  wd <- file.path(tempdir(), 'aotus')
-  # setup for aotus, make sure aotus/ folder already exists
-  if (!dir.exists(wd)) {
-    dir.create(wd)
-  }
-  ncbi_dr <- '[SET BLAST+ BIN PATH HERE]'
-  setup(wd = wd, txid = 9504, ncbi_dr = ncbi_dr)  # txid for Aotus primate genus
-  # run
-  # run(wd = wd) # not running in test
-  # use ctrl+c or Esc to kill
-  # change parameters, e.g. min and max sequence lengths
-  parameters_reset(wd = 'aotus', parameters = c('mnsql', 'mxsql'),
-                   values = c(300, 1500))
-  # see ?parameters
-  # restart
-  restart(wd = wd)
-# }
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/parameters_setup.html b/docs/reference/parameters_setup.html deleted file mode 100644 index 3d9b10b..0000000 --- a/docs/reference/parameters_setup.html +++ /dev/null @@ -1,215 +0,0 @@ - - - - - - - - -Set Up Parameters — parameters_setup • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Set Up Parameters

    - Source: R/pipeline-tools.R - -
    - -
    - -

    Initiates cache of parameters.

    - -
    - - 
    parameters_setup(wd, ncbi_execs, overwrite = FALSE, ...)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - -
    wd

    Working directory

    ncbi_execs

    File directories for NCBI tools, see blast_setup()

    overwrite

    Overwrite existing cache?

    ...

    Set parameters, see parameters()

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/parent_get.html b/docs/reference/parent_get.html deleted file mode 100644 index 603a5cf..0000000 --- a/docs/reference/parent_get.html +++ /dev/null @@ -1,216 +0,0 @@ - - - - - - - - -Get taxonomic parent — parent_get • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Get taxonomic parent

    - Source: R/tools-txdct.R - -
    - -
    - -

    Look-up MRCA of taxonomic id(s) from taxonomic -dictionary

    - -
    - - 
    parent_get(id, txdct)
    - -

    Arguments

    - - - - - - - - - - -
    id

    txid(s)

    txdct

    TaxDict

    - -

    Value

    - -

    Character

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/plot_phylota_pa-1.png b/docs/reference/plot_phylota_pa-1.png deleted file mode 100644 index eb2ecb5..0000000 Binary files a/docs/reference/plot_phylota_pa-1.png and /dev/null differ diff --git a/docs/reference/plot_phylota_pa-2.png b/docs/reference/plot_phylota_pa-2.png deleted file mode 100644 index b2d6a3d..0000000 Binary files a/docs/reference/plot_phylota_pa-2.png and /dev/null differ diff --git a/docs/reference/plot_phylota_pa.html b/docs/reference/plot_phylota_pa.html deleted file mode 100644 index 6739f6c..0000000 --- a/docs/reference/plot_phylota_pa.html +++ /dev/null @@ -1,230 +0,0 @@ - - - - - - - - -Plot presence/absence matrix — plot_phylota_pa • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Plot presence/absence matrix

    - Source: R/user-special.R - -
    - -
    - -

    Plot presence/absence of taxa by each -cluster in phylota object.

    - -
    - - 
    plot_phylota_pa(phylota, cids, txids, cnms = cids, txnms = txids)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - -
    phylota

    Phylota object

    cids

    Vector of cluster IDs

    txids

    Vector of taxonomic IDs

    cnms

    Cluster names

    txnms

    Taxonomic names

    - -

    Value

    - -

    geom_object

    - -

    Details

    - -

    Cluster names and taxonomic names can be given to the function, by -default IDs are used.

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_clstrs, drop_sqs, - get_clstr_slot, get_nsqs, - get_ntaxa, get_sq_slot, - get_stage_times, get_tx_slot, - get_txids, is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -

    Examples

    - 
    library(phylotaR)
-data(cycads)
-# drop all but first ten
-cycads <- drop_clstrs(cycads, cycads@cids[1:10])
-# plot all
-p <- plot_phylota_pa(phylota = cycads, cids = cycads@cids, txids = cycads@txids)
-print(p)  # lots of information, difficult to interpret
    # get genus-level taxonomic names
-genus_txids <- get_txids(cycads, txids = cycads@txids, rnk = 'genus')
-genus_txids <- unique(genus_txids)
-# dropping missing
-genus_txids <- genus_txids[genus_txids !=  '']
-genus_nms <- get_tx_slot(cycads, genus_txids, slt_nm = 'scnm')
-# make alphabetical for plotting
-genus_nms <- sort(genus_nms, decreasing = TRUE)
-# generate geom_object
-p <- plot_phylota_pa(phylota = cycads, cids = cycads@cids, txids = genus_txids,
-                     txnms = genus_nms)
-# plot
-print(p)  # easier to interpret
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/plot_phylota_treemap-1.png b/docs/reference/plot_phylota_treemap-1.png deleted file mode 100644 index c2c6b7c..0000000 Binary files a/docs/reference/plot_phylota_treemap-1.png and /dev/null differ diff --git a/docs/reference/plot_phylota_treemap-2.png b/docs/reference/plot_phylota_treemap-2.png deleted file mode 100644 index 9cb6f12..0000000 Binary files a/docs/reference/plot_phylota_treemap-2.png and /dev/null differ diff --git a/docs/reference/plot_phylota_treemap.html b/docs/reference/plot_phylota_treemap.html deleted file mode 100644 index 7b8a6ae..0000000 --- a/docs/reference/plot_phylota_treemap.html +++ /dev/null @@ -1,245 +0,0 @@ - - - - - - - - -Plot treemap of Phylota object — plot_phylota_treemap • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Plot treemap of Phylota object

    - Source: R/user-special.R - -
    - -
    - -

    Treemaps show relative size with boxes. The user can -explore which taxa or clusters are most represented either by -sequence or cluster number. If cluster IDs are provided, the plot -is made for clusters. If taxonomic IDs are provided, the plot is -made for taxa.

    - -
    - - 
    plot_phylota_treemap(phylota, cids = NULL, txids = NULL, cnms = cids,
-  txnms = txids, with_labels = TRUE, area = c("ntx", "nsq", "ncl"),
-  fill = c("NULL", "typ", "ntx", "nsq", "ncl"))
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    phylota

    Phylota object

    cids

    Cluster IDs

    txids

    Taxonomic IDs

    cnms

    Cluster names

    txnms

    Taxonomic names

    with_labels

    Show names per box?

    area

    What determines the size per box?

    fill

    What determines the coloured fill per box?

    - -

    Value

    - -

    geom_object

    - -

    Details

    - -

    The function can take a long time to run for large Phylota -objects over many taxonomic IDs because searches are made across -lineages. The idea of the function is to assess the data dominance -of specific clusters and taxa.

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_clstrs, drop_sqs, - get_clstr_slot, get_nsqs, - get_ntaxa, get_sq_slot, - get_stage_times, get_tx_slot, - get_txids, is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - read_phylota, write_sqs

    - - -

    Examples

    - 
    data("tinamous")
-# Plot clusters, size by n. sq, fill by n. tx
-p <- plot_phylota_treemap(phylota = tinamous, cids = tinamous@cids,
-                          area = 'nsq', fill = 'ntx')
-print(p)
    # Plot taxa, size by n. sq, fill by ncl
-txids <- get_txids(tinamous, txids = tinamous@txids, rnk = 'genus')
-txids <- txids[txids !=  '']
-txids <- unique(txids)
-txnms <- get_tx_slot(tinamous, txids, slt_nm = 'scnm')
-p <- plot_phylota_treemap(phylota = tinamous, txids = txids, txnms = txnms,
-                          area = 'nsq', fill = 'ncl')
-print(p)
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/progress_init.html b/docs/reference/progress_init.html deleted file mode 100644 index cb90e99..0000000 --- a/docs/reference/progress_init.html +++ /dev/null @@ -1,206 +0,0 @@ - - - - - - - - -Initialise progress list in cache — progress_init • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Initialise progress list in cache

    - Source: R/tools-cache.R - -
    - -
    - -

    Creates a progress list recording each stage run in -cache.

    - -
    - - 
    progress_init(wd)
    - -

    Arguments

    - - - - - - -
    wd

    Working directory

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/progress_read.html b/docs/reference/progress_read.html deleted file mode 100644 index 6261cf0..0000000 --- a/docs/reference/progress_read.html +++ /dev/null @@ -1,210 +0,0 @@ - - - - - - - - -Read the progress from cache — progress_read • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Read the progress from cache

    - Source: R/tools-cache.R - -
    - -
    - -

    Return the last completed stage using the cache.

    - -
    - - 
    progress_read(wd)
    - -

    Arguments

    - - - - - - -
    wd

    Working directory

    - -

    Value

    - -

    stage name, character, or NA is complete

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/progress_reset.html b/docs/reference/progress_reset.html deleted file mode 100644 index 1aa9c68..0000000 --- a/docs/reference/progress_reset.html +++ /dev/null @@ -1,214 +0,0 @@ - - - - - - - - -Reset progress — progress_reset • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Reset progress

    - Source: R/tools-cache.R - -
    - -
    - -

    Reset progress to an earlier completed stage.

    - -
    - - 
    progress_reset(wd, stg)
    - -

    Arguments

    - - - - - - - - - - -
    wd

    Working directory

    stg

    Stage to which the pipeline will be reset

    - -

    Details

    - -

    For example, resetting the progress to 'download' -mark stages 'download', 'cluster' and 'cluster2' as un-run.

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/progress_save.html b/docs/reference/progress_save.html deleted file mode 100644 index 20d09a2..0000000 --- a/docs/reference/progress_save.html +++ /dev/null @@ -1,207 +0,0 @@ - - - - - - - - -Save current progress — progress_save • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Save current progress

    - Source: R/tools-cache.R - -
    - -
    - -

    Stores the pipeline progress in the cache.

    - -
    - - 
    progress_save(wd, stg)
    - -

    Arguments

    - - - - - - - - - - -
    wd

    Working directory

    stg

    Stage

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/rank_get.html b/docs/reference/rank_get.html deleted file mode 100644 index 59250ff..0000000 --- a/docs/reference/rank_get.html +++ /dev/null @@ -1,214 +0,0 @@ - - - - - - - - -Get rank — rank_get • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Get rank

    - Source: R/tools-txdct.R - -
    - -
    - -

    Look-up taxonomic rank from dictionary.

    - -
    - - 
    rank_get(txid, txdct)
    - -

    Arguments

    - - - - - - - - - - -
    txid

    txid

    txdct

    TaxDict

    - -

    Value

    - -

    character

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/rawseqrec_breakdown.html b/docs/reference/rawseqrec_breakdown.html deleted file mode 100644 index 767be65..0000000 --- a/docs/reference/rawseqrec_breakdown.html +++ /dev/null @@ -1,219 +0,0 @@ - - - - - - - - -Breakdown a sequence record into its features — rawseqrec_breakdown • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Breakdown a sequence record into its features

    - Source: R/tools-sqs.R - -
    - -
    - -

    Takes GenBank record's elements and returns a SeqRec. For -sequences with lots of features, the sequence is broken down into these -features provided they are of the right size. Sequences are either returned -as features or whole sequence records, never both.

    - -
    - - 
    rawseqrec_breakdown(record_parts, ps)
    - -

    Arguments

    - - - - - - - - - - -
    record_parts

    list of record elements from a GenBank record

    ps

    Parameters list, generated with parameters()

    - -

    Value

    - -

    list of SeqRecs

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/read_phylota.html b/docs/reference/read_phylota.html deleted file mode 100644 index 2da5930..0000000 --- a/docs/reference/read_phylota.html +++ /dev/null @@ -1,196 +0,0 @@ - - - - - - - - -Generate a Phylota object in R — read_phylota • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Generate a Phylota object in R

    - Source: R/user-special.R - -
    - -
    - -

    Creates a Phylota object containing information on -clusters, sequences and taxonomy from the working directory of a -completed pipeline.

    - -
    - - 
    read_phylota(wd)
    - -

    Arguments

    - - - - - - -
    wd

    Working directory

    - -

    Value

    - -

    Phylota

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_clstrs, drop_sqs, - get_clstr_slot, get_nsqs, - get_ntaxa, get_sq_slot, - get_stage_times, get_tx_slot, - get_txids, is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - write_sqs

    - - -

    Examples

    - 
    # NOT RUN {
-
-  # Note, this example requires a wd with a completed phylotaR run
-  phylota <- read_phylota(wd)
-# }
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/reset.html b/docs/reference/reset.html deleted file mode 100644 index 300a4db..0000000 --- a/docs/reference/reset.html +++ /dev/null @@ -1,202 +0,0 @@ - - - - - - - - -Reset a phylotaR pipeline run — reset • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Reset a phylotaR pipeline run

    - Source: R/pipeline.R - -
    - -
    - -

    Resets the pipeline to a specified stage.

    - -
    - - 
    reset(wd, stage, hard = FALSE)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    wd

    Working directory

    stage

    Name of stage to which the pipeline will be reset

    hard

    T/F, delete all cached data?

    - -

    See also

    - -

    Other run-public: ClstrArc-class, - ClstrRec-class, - Phylota-class, SeqArc-class, - SeqRec-class, TaxDict-class, - TaxRec-class, clusters2_run, - clusters_run, - parameters_reset, restart, - run, setup, - taxise_run

    - - -

    Examples

    - 
    # NOT RUN {
-
-  # Note: this example requires BLAST and internet to run.
-
-  # example with temp folder
-  wd <- file.path(tempdir(), 'aotus')
-  # setup for aotus, make sure aotus/ folder already exists
-  if (!dir.exists(wd)) {
-    dir.create(wd)
-  }
-  ncbi_dr <- '[SET BLAST+ BIN PATH HERE]'
-  setup(wd = wd, txid = 9504, ncbi_dr = ncbi_dr)  # txid for Aotus primate genus
-  # individually run taxise
-  taxise_run(wd = wd)
-  # reset back to taxise as if it has not been run
-  reset(wd = 'aotus', stage = 'taxise')
-  # run taxise again ....
-  taxise_run(wd = wd)
-# }
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/restart.html b/docs/reference/restart.html deleted file mode 100644 index a4d15e8..0000000 --- a/docs/reference/restart.html +++ /dev/null @@ -1,201 +0,0 @@ - - - - - - - - -Restart a phylotaR pipeline run — restart • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Restart a phylotaR pipeline run

    - Source: R/pipeline.R - -
    - -
    - -

    Restarts the running of a pipeline -as started with run.

    - -
    - - 
    restart(wd, nstages = 4)
    - -

    Arguments

    - - - - - - - - - - -
    wd

    Working directory

    nstages

    Number of total stages to run, max 4.

    - -

    See also

    - -

    Other run-public: ClstrArc-class, - ClstrRec-class, - Phylota-class, SeqArc-class, - SeqRec-class, TaxDict-class, - TaxRec-class, clusters2_run, - clusters_run, - parameters_reset, reset, - run, setup, - taxise_run

    - - -

    Examples

    - 
    # NOT RUN {
-
-  # Note: this example requires BLAST and internet to run.
-
-  # example with temp folder
-  wd <- file.path(tempdir(), 'aotus')
-  # setup for aotus, make sure aotus/ folder already exists
-  if (!dir.exists(wd)) {
-    dir.create(wd)
-  }
-  ncbi_dr <- '[SET BLAST+ BIN PATH HERE]'
-  setup(wd = wd, txid = 9504, ncbi_dr = ncbi_dr)  # txid for Aotus primate genus
-  # run and stop after 10 seconds
-  R.utils::withTimeout(expr = {
-    run(wd = wd)
-  }, timeout = 10)
-  # use ctrl+c or Esc to kill without a timelimit
-  # and restart with ....
-  restart(wd = wd)
-# }
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/run.html b/docs/reference/run.html deleted file mode 100644 index 2f947b9..0000000 --- a/docs/reference/run.html +++ /dev/null @@ -1,206 +0,0 @@ - - - - - - - - -Run phylotaR pipeline — run • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Run phylotaR pipeline

    - Source: R/pipeline.R - -
    - -
    - -

    Run the entire phylotaR pipeline. All generated files will be -stored in the wd. The process can be stopped at anytime and restarted with -restart. nstages must be a numeric value representing the -number of stages that will be run. Stages are run in the following order: -1 - taxise, 2 - download, 3 - cluster and 4 - cluster2.

    -

    For example, specifying nstages = 3, will run taxise, download and -cluster. Stages can also be run individually, see linked functions below.

    - -
    - - 
    run(wd, nstages = 4)
    - -

    Arguments

    - - - - - - - - - - -
    wd

    Working directory

    nstages

    Number of total stages to run, max 4.

    - -

    See also

    - -

    Other run-public: ClstrArc-class, - ClstrRec-class, - Phylota-class, SeqArc-class, - SeqRec-class, TaxDict-class, - TaxRec-class, clusters2_run, - clusters_run, - parameters_reset, reset, - restart, setup, - taxise_run

    - - -

    Examples

    - 
    # NOT RUN {
-
-  # Note: this example requires BLAST and internet to run.
-
-  # example with temp folder
-  wd <- file.path(tempdir(), 'aotus')
-  # setup for aotus, make sure aotus/ folder already exists
-  if (!dir.exists(wd)) {
-    dir.create(wd)
-  }
-  ncbi_dr <- '[SET BLAST+ BIN PATH HERE]'
-  # e.g. "/usr/local/ncbi/blast/bin/"
-  setup(wd = wd, txid = 9504, ncbi_dr = ncbi_dr)  # txid for Aotus primate genus
-  run(wd = wd)
-# }
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/safely_connect.html b/docs/reference/safely_connect.html deleted file mode 100644 index 981c8c1..0000000 --- a/docs/reference/safely_connect.html +++ /dev/null @@ -1,223 +0,0 @@ - - - - - - - - -Safely run rentrez function — safely_connect • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Safely run rentrez function

    - Source: R/tools-api.R - -
    - -
    - -

    Safely run a rentrez function. If the query fails, -the function will retry.

    - -
    - - 
    safely_connect(func, args, fnm, ps)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - -
    func

    rentrez function

    args

    rentrez function arguments, list

    fnm

    rentrez function name

    ps

    Parameters list, generated with parameters()

    - -

    Value

    - -

    rentrez function results

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/search_and_cache.html b/docs/reference/search_and_cache.html deleted file mode 100644 index 6c3f271..0000000 --- a/docs/reference/search_and_cache.html +++ /dev/null @@ -1,225 +0,0 @@ - - - - - - - - -Run rentrez function and cache results — search_and_cache • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Run rentrez function and cache results

    - Source: R/tools-api.R - -
    - -
    - -

    Safely run a rentrez function. If the query fails, the -function will retry. All query results are cached. To remove cached -data use hard reset.

    - -
    - - 
    search_and_cache(func, args, fnm, ps)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - -
    func

    rentrez function

    args

    rentrez function arguments, list

    fnm

    rentrez function name

    ps

    Parameters list, generated with parameters()

    - -

    Value

    - -

    rentrez function results

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/searchterm_gen.html b/docs/reference/searchterm_gen.html deleted file mode 100644 index f83dd37..0000000 --- a/docs/reference/searchterm_gen.html +++ /dev/null @@ -1,223 +0,0 @@ - - - - - - - - -Construct GenBank Search Term — searchterm_gen • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Construct GenBank Search Term

    - Source: R/tools-entrez.R - -
    - -
    - -

    Construct search term for searching GenBank's -nucleotide database. Limits the maximum size of sequences, avoids -whole genome shotguns, predicted, unverified and synthetic -sequences.

    - -
    - - 
    searchterm_gen(txid, ps, direct = FALSE)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    txid

    Taxonomic ID

    ps

    Parameters list, generated with parameters()

    direct

    Node-level only or subtree as well? Default FALSE.

    - -

    Value

    - -

    character, search term

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - seeds_blast, seq_download, - seqarc_gen, seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/seeds_blast.html b/docs/reference/seeds_blast.html deleted file mode 100644 index 8288f65..0000000 --- a/docs/reference/seeds_blast.html +++ /dev/null @@ -1,213 +0,0 @@ - - - - - - - - -BLAST seed sequences — seeds_blast • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    BLAST seed sequences

    - Source: R/stage4-tools.R - -
    - -
    - -

    Runs all-v-all blast for seed sequences.

    - -
    - - 
    seeds_blast(sqs, ps)
    - -

    Arguments

    - - - - - - - - - - -
    sqs

    All seed sequences to be BLASTed

    ps

    Parameters list, generated with parameters()

    - -

    Value

    - -

    blast res data.frame

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seq_download, - seqarc_gen, seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/seq_download.html b/docs/reference/seq_download.html deleted file mode 100644 index 21feb78..0000000 --- a/docs/reference/seq_download.html +++ /dev/null @@ -1,219 +0,0 @@ - - - - - - - - -Download sequences for txids — seq_download • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Download sequences for txids

    - Source: R/stage2.R - -
    - -
    - -

    Look up and download all sequences for given -taxonomic IDs.

    - -
    - - 
    seq_download(txids, txdct, ps)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    txids

    Taxonomic node IDs, numeric vector

    txdct

    Taxonomic dictionary

    ps

    Parameters list, generated with parameters()

    - -

    Details

    - -

    Sequence downloads are cached.

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seqarc_gen, seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/seqarc_gen.html b/docs/reference/seqarc_gen.html deleted file mode 100644 index 26d43a4..0000000 --- a/docs/reference/seqarc_gen.html +++ /dev/null @@ -1,209 +0,0 @@ - - - - - - - - -Generate sequence archive — seqarc_gen • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Generate sequence archive

    - Source: R/tools-sqs.R - -
    - -
    - -

    Creates an S4 SeqArc from list of SeqRecs

    - -
    - - 
    seqarc_gen(seqrecs)
    - -

    Arguments

    - - - - - - -
    seqrecs

    List of SeqRecs

    - -

    Value

    - -

    SeqArc

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/seqrec_augment.html b/docs/reference/seqrec_augment.html deleted file mode 100644 index e33443b..0000000 --- a/docs/reference/seqrec_augment.html +++ /dev/null @@ -1,213 +0,0 @@ - - - - - - - - -Augment sequence records list — seqrec_augment • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Augment sequence records list

    - Source: R/stage2-tools.R - -
    - -
    - -

    Add taxids to records and convert to archive.

    - -
    - - 
    seqrec_augment(sqs, txdct)
    - -

    Arguments

    - - - - - - - - - - -
    sqs

    List of SeqRecs

    txdct

    Taxonomic Dictionary

    - -

    Value

    - -

    SeqArc

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/seqrec_convert.html b/docs/reference/seqrec_convert.html deleted file mode 100644 index 585b03d..0000000 --- a/docs/reference/seqrec_convert.html +++ /dev/null @@ -1,215 +0,0 @@ - - - - - - - - -Convert raw Entrez gb text record to SeqRecs — seqrec_convert • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Convert raw Entrez gb text record to SeqRecs

    - Source: R/tools-sqs.R - -
    - -
    - -

    Parses returned sequences features with Entrez, returns one or -more SeqRec objects for each raw record.

    - -
    - - 
    seqrec_convert(raw_recs, ps)
    - -

    Arguments

    - - - - - - - - - - -
    raw_recs

    Raw text records returned from Entrez fetch

    ps

    Parameters list, generated with parameters()

    - -

    Value

    - -

    SeqRecs

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/seqrec_gen.html b/docs/reference/seqrec_gen.html deleted file mode 100644 index 6d95ea9..0000000 --- a/docs/reference/seqrec_gen.html +++ /dev/null @@ -1,250 +0,0 @@ - - - - - - - - -Generate sequence record — seqrec_gen • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Generate sequence record

    - Source: R/tools-sqs.R - -
    - -
    - -

    Creates an S4 SeqRec

    - -
    - - 
    seqrec_gen(accssn, nm, txid, sq, dfln, orgnsm, ml_typ, rec_typ, vrsn, age,
-  lctn = NULL)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    accssn

    Accession ID

    nm

    Sequence name

    txid

    Taxonomic ID of source organism

    sq

    Sequence

    dfln

    Definition line

    orgnsm

    Source organism name

    ml_typ

    Molecule type

    rec_typ

    Sequence record type

    vrsn

    Accession version

    age

    Number of days since upload

    lctn

    Location numbers for features, e.g. '1..200'

    - -

    Value

    - -

    SeqRec

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_get, - sids_check, sids_get, - sids_load, sids_save, - sqs_count, sqs_save, - stage_args_check, stages_run, - tax_download, taxdict_gen, - taxtree_gen, txids_get, - txnds_count, warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/seqrec_get.html b/docs/reference/seqrec_get.html deleted file mode 100644 index 2637b05..0000000 --- a/docs/reference/seqrec_get.html +++ /dev/null @@ -1,230 +0,0 @@ - - - - - - - - -seqrec_get — seqrec_get • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    seqrec_get

    - Source: R/stage2-tools.R - -
    - -
    - -

    Downloads sequences from GenBank in batches.

    - -
    - - 
    seqrec_get(txid, ps, direct = FALSE, lvl = 0)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - -
    txid

    NCBI taxonomic ID

    ps

    Parameters list, generated with parameters()

    direct

    Node-level only or subtree as well? Default FALSE.

    lvl

    Integer, number of message indentations indicating code -depth.

    - -

    Value

    - -

    Vector of sequence records

    - -

    Details

    - -

    If a restez database is available and the number of sequences to -retrieve is less than 'btchsz', the function will look the sequences up -from the database rather than download.

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - sids_check, sids_get, - sids_load, sids_save, - sqs_count, sqs_save, - stage_args_check, stages_run, - tax_download, taxdict_gen, - taxtree_gen, txids_get, - txnds_count, warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/setup.html b/docs/reference/setup.html deleted file mode 100644 index e026e86..0000000 --- a/docs/reference/setup.html +++ /dev/null @@ -1,218 +0,0 @@ - - - - - - - - -Set-up parameters — setup • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Set-up parameters

    - Source: R/pipeline.R - -
    - -
    - -

    Set up working directory with parameters.

    - -
    - - 
    setup(wd, txid, ncbi_dr = ".", v = FALSE, overwrite = FALSE, ...)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - - - - - -
    wd

    Working directory

    txid

    Root taxonomic ID(s), vector or numeric

    ncbi_dr

    Directory to NCBI BLAST tools, default '.'

    v

    Verbose, T/F

    overwrite

    Overwrite existing cache?

    ...

    Additional parameters

    - -

    Details

    - -

    See parameters() for a description of all parameters -and their defaults. You can change parameters after a folder has been set up -with parameters_reset().

    - -

    See also

    - -

    Other run-public: ClstrArc-class, - ClstrRec-class, - Phylota-class, SeqArc-class, - SeqRec-class, TaxDict-class, - TaxRec-class, clusters2_run, - clusters_run, - parameters_reset, reset, - restart, run, - taxise_run

    - - -

    Examples

    - 
    # NOT RUN {
-
-  # Note: this example requires BLAST to run.
-
-  # example with temp folder
-  wd <- file.path(tempdir(), 'aotus')
-  # setup for aotus, make sure aotus/ folder already exists
-  if (!dir.exists(wd)) {
-    dir.create(wd)
-  }
-  ncbi_dr <- '[SET BLAST+ BIN PATH HERE]'
-  # e.g. "/usr/local/ncbi/blast/bin/"
-  setup(wd = wd, txid = 9504, ncbi_dr = ncbi_dr)  # txid for Aotus primate genus
-  # see ?parameters for all available parameter options
-# }
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/sids_check.html b/docs/reference/sids_check.html deleted file mode 100644 index e208f93..0000000 --- a/docs/reference/sids_check.html +++ /dev/null @@ -1,239 +0,0 @@ - - - - - - - - -Check if sids exist — sids_check • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Check if sids exist

    - Source: R/tools-cache.R - -
    - -
    - -

    Check if sids are already downloaded for a txid.

    - -
    - - 
    sids_check(wd, txid)
    - -

    Arguments

    - - - - - - - - - - -
    wd

    Working directory

    txid

    Taxonomic ID, numeric

    - -

    Value

    - -

    T/F

    - -

    Details

    - -

    #' @name sqs_load -#' @title Load sequences from cache -#' @description Load sequences downloaded by dwnld function. -#' @param wd Working directory -#' @param txid Taxonomic ID, numeric -#' @family run-private -#' @return SeqArc -sqs_load <- function(wd, txid) - d <- file.path(wd, 'cache') - if (!file.exists(d)) - stop('Cache does not exist.') - d <- file.path(d, 'sqs') - if (!file.exists(d)) - stop('`sqs` not in cache. Have you run the download stage?') - fl <- file.path(d, paste0(txid, '.RData')) - if (!file.exists(fl)) - stop(paste0('[', txid, '] not in `sqs` of cache.')) - sqs <- try(readRDS(file = fl), silent = TRUE) - if (inherits(sqs, 'try-error')) - file.remove(fl) - sqs

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_get, - sids_load, sids_save, - sqs_count, sqs_save, - stage_args_check, stages_run, - tax_download, taxdict_gen, - taxtree_gen, txids_get, - txnds_count, warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/sids_get.html b/docs/reference/sids_get.html deleted file mode 100644 index 058ea2c..0000000 --- a/docs/reference/sids_get.html +++ /dev/null @@ -1,242 +0,0 @@ - - - - - - - - -Return random set of sequence IDs — sids_get • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Return random set of sequence IDs

    - Source: R/tools-entrez.R - -
    - -
    - -

    For a given txid return a random set of -sequences associated.

    - -
    - - 
    sids_get(txid, direct, ps, retmax = 100, hrdmx = 1e+05)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - -
    txid

    NCBI taxon identifier

    direct

    Node-level only or subtree as well? Default FALSE.

    ps

    Parameters list, generated with parameters()

    retmax

    Maximum number of sequences when querying model -organisms. The smaller the more random, the larger the faster.

    hrdmx

    Absolute maximum number of sequence IDs to download -in a single query.

    - -

    Value

    - -

    vector of IDs

    - -

    Details

    - -

    For model organisms downloading all IDs can a take long -time or even cause an xml parsing error. For any search with more -than hrdmx sequences, this function we will run multiple small -searches downloading retmax seq IDs at a time with different -retstart values to generate a semi-random vector of sequence IDs. -For all other searches, all IDs will be retrieved. Note, it makes -no sense for mdlthrs in parameters to be greater than hrdmx in this -function.

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_load, sids_save, - sqs_count, sqs_save, - stage_args_check, stages_run, - tax_download, taxdict_gen, - taxtree_gen, txids_get, - txnds_count, warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/sids_load.html b/docs/reference/sids_load.html deleted file mode 100644 index dd4bb6c..0000000 --- a/docs/reference/sids_load.html +++ /dev/null @@ -1,213 +0,0 @@ - - - - - - - - -Load sids from cache — sids_load • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Load sids from cache

    - Source: R/tools-cache.R - -
    - -
    - -

    Load sids downloaded by sids_get function.

    - -
    - - 
    sids_load(wd, txid)
    - -

    Arguments

    - - - - - - - - - - -
    wd

    Working directory

    txid

    Taxonomic ID, numeric

    - -

    Value

    - -

    vector of sids

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_save, - sqs_count, sqs_save, - stage_args_check, stages_run, - tax_download, taxdict_gen, - taxtree_gen, txids_get, - txnds_count, warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/sids_save.html b/docs/reference/sids_save.html deleted file mode 100644 index c2aa445..0000000 --- a/docs/reference/sids_save.html +++ /dev/null @@ -1,211 +0,0 @@ - - - - - - - - -Save sids to cache — sids_save • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Save sids to cache

    - Source: R/tools-cache.R - -
    - -
    - -

    Saves sids downloaded

    - -
    - - 
    sids_save(wd, txid, sids)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    wd

    Working directory

    txid

    Taxonomic ID, numeric

    sids

    sids

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sqs_count, sqs_save, - stage_args_check, stages_run, - tax_download, taxdict_gen, - taxtree_gen, txids_get, - txnds_count, warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/sqs_count.html b/docs/reference/sqs_count.html deleted file mode 100644 index 38ecf28..0000000 --- a/docs/reference/sqs_count.html +++ /dev/null @@ -1,219 +0,0 @@ - - - - - - - - -Count number of sequences for txid — sqs_count • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Count number of sequences for txid

    - Source: R/tools-entrez.R - -
    - -
    - -

    Return the number of sequences associated with a -taxonomic ID on NCBI GenBank.

    - -
    - - 
    sqs_count(txid, ps, direct = FALSE)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    txid

    Taxonomic ID

    ps

    Parameters list, generated with parameters()

    direct

    Node-level only or subtree as well? Default FALSE.

    - -

    Value

    - -

    integer

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_save, - stage_args_check, stages_run, - tax_download, taxdict_gen, - taxtree_gen, txids_get, - txnds_count, warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/sqs_load.html b/docs/reference/sqs_load.html deleted file mode 100644 index 811a165..0000000 --- a/docs/reference/sqs_load.html +++ /dev/null @@ -1,208 +0,0 @@ - - - - - - - - -Load sequences from cache — sqs_load • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Load sequences from cache

    - Source: R/tools-cache.R - -
    - -
    - -

    Load sequences downloaded by dwnld function.

    - -
    - - 
    sqs_load(wd, txid)
    - -

    Arguments

    - - - - - - - - - - -
    wd

    Working directory

    txid

    Taxonomic ID, numeric

    - -

    Value

    - -

    SeqArc

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count, - warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown.

    -
    - -
    -
    - - - - - - diff --git a/docs/reference/sqs_save.html b/docs/reference/sqs_save.html deleted file mode 100644 index c48405d..0000000 --- a/docs/reference/sqs_save.html +++ /dev/null @@ -1,218 +0,0 @@ - - - - - - - - -Save sequences to cache — sqs_save • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Save sequences to cache

    - Source: R/tools-cache.R - -
    - -
    - -

    Saves sequences downloaded

    - -
    - - 
    sqs_save(wd, txid, sqs)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    wd

    Working directory

    txid

    Taxonomic ID, numeric

    sqs

    Sequences

    - -

    Details

    - -

    Used within the dwnld function. Saves -sequence data by txid in cache.

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - stage_args_check, stages_run, - tax_download, taxdict_gen, - taxtree_gen, txids_get, - txnds_count, warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/stage_args_check.html b/docs/reference/stage_args_check.html deleted file mode 100644 index a2a55df..0000000 --- a/docs/reference/stage_args_check.html +++ /dev/null @@ -1,213 +0,0 @@ - - - - - - - - -Check stage arguments — stage_args_check • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Check stage arguments

    - Source: R/pipeline-tools.R - -
    - -
    - -

    Ensures stage arguments are valid, raises an error if not.

    - -
    - - 
    stage_args_check(to, frm)
    - -

    Arguments

    - - - - - - - - - - -
    to

    ending stage

    frm

    starting stage

    - -

    Value

    - -

    character, stage message

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stages_run, - tax_download, taxdict_gen, - taxtree_gen, txids_get, - txnds_count, warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/stages_run.html b/docs/reference/stages_run.html deleted file mode 100644 index c0064a2..0000000 --- a/docs/reference/stages_run.html +++ /dev/null @@ -1,221 +0,0 @@ - - - - - - - - -Sequentially run each stage — stages_run • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Sequentially run each stage

    - Source: R/pipeline-tools.R - -
    - -
    - -

    Runs stages from frm to to. Records stage progress -in cache.

    - -
    - - 
    stages_run(wd, to, frm, stgs_msg, rstrt = FALSE)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - -
    wd

    Working directory

    to

    Total number of stages to run

    frm

    Starting stage to run from

    stgs_msg

    Printout stage message for log

    rstrt

    Restarting, T/F

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - tax_download, taxdict_gen, - taxtree_gen, txids_get, - txnds_count, warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/sturgeons.rd b/docs/reference/sturgeons.rd deleted file mode 100644 index a1e4ede..0000000 --- a/docs/reference/sturgeons.rd +++ /dev/null @@ -1,163 +0,0 @@ - - - - - - - - -Example phylota object (sturgeons) — sturgeons • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Example phylota object (sturgeons)

    - - -
    - -
    - -

    Final phylota object produced by running pipeline for the sturgeons, Acipenseridae (7900).

    - -
    - - 
    data(sturgeons)
    - -

    Format

    - -

    sturgeons is generated from read_phylota().

    - - -

    Examples

    - 
    data(sturgeons) # load object
-str(sturgeons)
    #> Formal class 'Phylota' [package "phylotaR"] with 8 slots
-#>   ..@ cids   : chr [1:332] "0" "1" "2" "3" ...
-#>   ..@ txids  : chr [1:51] "328639" "1358436" "228914" "1358431" ...
-#>   ..@ sids   : chr [1:2417] "MG670582.1/72..978" "MG670581.1/63..1129" "MG670580.1/64..1130" "MG670579.1/71..1137" ...
-#>   ..@ txdct  :Formal class 'TaxDict' [package "phylotaR"] with 4 slots
-#>   ..@ sqs    :Formal class 'SeqArc' [package "phylotaR"] with 5 slots
-#>   ..@ clstrs :Formal class 'ClstrArc' [package "phylotaR"] with 2 slots
-#>   ..@ prnt_id: chr "7900"
-#>   ..@ prnt_nm: chr "Acipenseridae"
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown.

    -
    - -
    -
    - - - - - - diff --git a/docs/reference/summary_phylota.html b/docs/reference/summary_phylota.html deleted file mode 100644 index 6e2de9f..0000000 --- a/docs/reference/summary_phylota.html +++ /dev/null @@ -1,167 +0,0 @@ - - - - - - - - -Summarise clusters in Phylota Table — summary_phylota • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Summarise clusters in Phylota Table

    - Source: R/user-special.R - -
    - -
    - -

    Generates a summary data.frame from all clusters in -Phylota object.

    - -
    - - 
    summary_phylota(phylota)
    - -

    Arguments

    - - - - - - -
    phylota

    Phylota object

    - -

    See also

    - -

    Other tools-private: mk_txid_in_sq_mtrx, - update_phylota

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/tardigrades.rd b/docs/reference/tardigrades.rd deleted file mode 100644 index 7d68d2d..0000000 --- a/docs/reference/tardigrades.rd +++ /dev/null @@ -1,163 +0,0 @@ - - - - - - - - -Example phylota object (tardigrades) — tardigrades • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Example phylota object (tardigrades)

    - - -
    - -
    - -

    Final phylota object produced by running pipeline for the tardigrades, Eutardigrada (42242).

    - -
    - - 
    data(tardigrades)
    - -

    Format

    - -

    tardigrades is generated from read_phylota().

    - - -

    Examples

    - 
    data(tardigrades) # load object
-str(tardigrades)
    #> Formal class 'Phylota' [package "phylotaR"] with 8 slots
-#>   ..@ cids   : chr [1:195] "0" "1" "2" "3" ...
-#>   ..@ txids  : chr [1:261] "1767026" "1767025" "1353345" "467049" ...
-#>   ..@ sids   : chr [1:945] "KT951664.1" "KT951663.1" "KT951667.1" "KT951666.1" ...
-#>   ..@ txdct  :Formal class 'TaxDict' [package "phylotaR"] with 4 slots
-#>   ..@ sqs    :Formal class 'SeqArc' [package "phylotaR"] with 5 slots
-#>   ..@ clstrs :Formal class 'ClstrArc' [package "phylotaR"] with 2 slots
-#>   ..@ prnt_id: chr "42242"
-#>   ..@ prnt_nm: chr "Eutardigrada"
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown.

    -
    - -
    -
    - - - - - - diff --git a/docs/reference/tax_download.html b/docs/reference/tax_download.html deleted file mode 100644 index 01d38c7..0000000 --- a/docs/reference/tax_download.html +++ /dev/null @@ -1,215 +0,0 @@ - - - - - - - - -Download taxonomic records — tax_download • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Download taxonomic records

    - Source: R/stage1-tools.R - -
    - -
    - -

    Downloads one batch of taxonomic -records.

    - -
    - - 
    tax_download(ids, ps)
    - -

    Arguments

    - - - - - - - - - - -
    ids

    Vector of taxonomic IDs

    ps

    Parameters list, generated with parameters()

    - -

    Value

    - -

    list of list

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, taxdict_gen, - taxtree_gen, txids_get, - txnds_count, warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/taxdict_gen.html b/docs/reference/taxdict_gen.html deleted file mode 100644 index 58bed03..0000000 --- a/docs/reference/taxdict_gen.html +++ /dev/null @@ -1,219 +0,0 @@ - - - - - - - - -Generate taxonomic dictionary — taxdict_gen • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Generate taxonomic dictionary

    - Source: R/stage1.R - -
    - -
    - -

    Takes a vector of txids and a list -of taxonomic records and returns a taxonomic dictionary.

    - -
    - - 
    taxdict_gen(txids, recs, ps)
    - -

    Arguments

    - - - - - - - - - - - - - - -
    txids

    Vector of taxonomic IDs

    recs

    List of taxonomic records

    ps

    Parameters list, generated with parameters()

    - -

    Value

    - -

    TaxDict

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxtree_gen, txids_get, - txnds_count, warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/taxise_run.html b/docs/reference/taxise_run.html deleted file mode 100644 index 6b8ec40..0000000 --- a/docs/reference/taxise_run.html +++ /dev/null @@ -1,202 +0,0 @@ - - - - - - - - -Run taxise stage — taxise_run • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Run taxise stage

    - Source: R/stage1.R - -
    - -
    - -

    Run the first stage of phylotaR, taxise. This looks up -all descendant taxonomic nodes for a given taxonomic ID. It then -looks up relevant taxonomic information and generates a taxonomic -dictionary for user interaction after phylotaR has completed.

    - -
    - - 
    taxise_run(wd)
    - -

    Arguments

    - - - - - - -
    wd

    Working directory

    - -

    Details

    - -

    Objects will be cached.

    - -

    See also

    - -

    Other run-public: ClstrArc-class, - ClstrRec-class, - Phylota-class, SeqArc-class, - SeqRec-class, TaxDict-class, - TaxRec-class, clusters2_run, - clusters_run, - parameters_reset, reset, - restart, run, - setup

    - - -

    Examples

    - 
    # NOT RUN {
-
-  # Note: this example requires BLAST and internet to run.
-
-  # example with temp folder
-  wd <- file.path(tempdir(), 'aotus')
-  # setup for aotus, make sure aotus/ folder already exists
-  if (!dir.exists(wd)) {
-    dir.create(wd)
-  }
-  ncbi_dr <- '[SET BLAST+ BIN PATH HERE]'
-  setup(wd = wd, txid = 9504, ncbi_dr = ncbi_dr)  # txid for Aotus primate genus
-  # individually run stages
-  taxise_run(wd = wd)
-# }
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/taxtree_gen.html b/docs/reference/taxtree_gen.html deleted file mode 100644 index 8c82b5b..0000000 --- a/docs/reference/taxtree_gen.html +++ /dev/null @@ -1,224 +0,0 @@ - - - - - - - - -Generate taxonomic tree — taxtree_gen • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Generate taxonomic tree

    - Source: R/tools-txdct.R - -
    - -
    - -

    Generate a taxonomic tree for -easy look up of taxonomic parents and descendants.

    - -
    - - 
    taxtree_gen(prinds, ids, root, ps)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - -
    prinds

    Vector of integers indicating preceding node.

    ids

    Vector of taxonomic IDs

    root

    ID of root taxon

    ps

    Parameters list, generated with parameters()

    - -

    Value

    - -

    TreeMan

    -

    TreeMan class

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, txids_get, - txnds_count, warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/tinamous.rd b/docs/reference/tinamous.rd deleted file mode 100644 index 9f79018..0000000 --- a/docs/reference/tinamous.rd +++ /dev/null @@ -1,163 +0,0 @@ - - - - - - - - -Example phylota object (tinamous) — tinamous • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Example phylota object (tinamous)

    - - -
    - -
    - -

    Final phylota object produced by running pipeline for the tinamous, Tinamiformes (8802).

    - -
    - - 
    data(tinamous)
    - -

    Format

    - -

    tinamous is generated from read_phylota().

    - - -

    Examples

    - 
    data(tinamous) # load object
-str(tinamous)
    #> Formal class 'Phylota' [package "phylotaR"] with 8 slots
-#>   ..@ cids   : chr [1:98] "0" "1" "2" "3" ...
-#>   ..@ txids  : chr [1:25] "8805" "458187" "94827" "30464" ...
-#>   ..@ sids   : chr [1:250] "EU737940.1" "EU737938.1" "EU737484.1/1..469" "EU737481.1/1..475" ...
-#>   ..@ txdct  :Formal class 'TaxDict' [package "phylotaR"] with 4 slots
-#>   ..@ sqs    :Formal class 'SeqArc' [package "phylotaR"] with 5 slots
-#>   ..@ clstrs :Formal class 'ClstrArc' [package "phylotaR"] with 2 slots
-#>   ..@ prnt_id: chr "8802"
-#>   ..@ prnt_nm: chr "Tinamiformes"
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown.

    -
    - -
    -
    - - - - - - diff --git a/docs/reference/txids_get.html b/docs/reference/txids_get.html deleted file mode 100644 index f4c0cc3..0000000 --- a/docs/reference/txids_get.html +++ /dev/null @@ -1,214 +0,0 @@ - - - - - - - - -Searches for descendant taxonomic IDs — txids_get • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Searches for descendant taxonomic IDs

    - Source: R/stage1.R - -
    - -
    - -

    Searches NCBI taxonomy for all descendant taxonomic nodes.

    - -
    - - 
    txids_get(ps, retmax = 10000)
    - -

    Arguments

    - - - - - - - - - - -
    ps

    Parameters list, generated with parameters()

    retmax

    integer, maximum number of IDs to return per query

    - -

    Value

    - -

    Vector of txids

    -

    vector of ids

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txnds_count, warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/txnds_count.html b/docs/reference/txnds_count.html deleted file mode 100644 index 170b60e..0000000 --- a/docs/reference/txnds_count.html +++ /dev/null @@ -1,215 +0,0 @@ - - - - - - - - -Count number of descending taxonomic nodes — txnds_count • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Count number of descending taxonomic nodes

    - Source: R/tools-entrez.R - -
    - -
    - -

    Searches NCBI taxonomy and returns number of descendants -taxonomic nodes (species, genera ...) of ID.

    - -
    - - 
    txnds_count(txid, ps)
    - -

    Arguments

    - - - - - - - - - - -
    txid

    Taxonomic ID

    ps

    Parameters list, generated with parameters()

    - -

    Value

    - -

    integer

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, warn

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/update_phylota.html b/docs/reference/update_phylota.html deleted file mode 100644 index cae87a5..0000000 --- a/docs/reference/update_phylota.html +++ /dev/null @@ -1,171 +0,0 @@ - - - - - - - - -Update slots — update_phylota • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Update slots

    - Source: R/user-special.R - -
    - -
    - -

    After change, run to update slots.

    - -
    - - 
    update_phylota(phylota)
    - -

    Arguments

    - - - - - - -
    phylota

    Phylota

    - -

    Value

    - -

    Phylota

    - -

    See also

    - -

    Other tools-private: mk_txid_in_sq_mtrx, - summary_phylota

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/warn.html b/docs/reference/warn.html deleted file mode 100644 index 74b2c40..0000000 --- a/docs/reference/warn.html +++ /dev/null @@ -1,207 +0,0 @@ - - - - - - - - -Write warning message to log — warn • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Write warning message to log

    - Source: R/tools-log.R - -
    - -
    - -

    Inform a user if a potential error has occurred in log.txt.

    - -
    - - 
    warn(ps, ...)
    - -

    Arguments

    - - - - - - - - - - -
    ps

    Parameters list, generated with parameters()

    ...

    Message elements for concatenating

    - -

    See also

    - -

    Other run-private: batcher, - blast_clstr, blast_filter, - blast_setup, blast_sqs, - blastcache_load, - blastcache_save, blastdb_gen, - blastn_run, cache_rm, - cache_setup, clade_select, - clstr2_calc, clstr_all, - clstr_direct, clstr_sqs, - clstr_subtree, clstrarc_gen, - clstrarc_join, clstrrec_gen, - clstrs_calc, clstrs_join, - clstrs_merge, - clstrs_renumber, clstrs_save, - cmdln, descendants_get, - download_obj_check, error, - gb_extract, - hierarchic_download, info, - ncbicache_load, - ncbicache_save, obj_check, - obj_load, obj_save, - parameters_load, - parameters_setup, parent_get, - progress_init, progress_read, - progress_reset, - progress_save, rank_get, - rawseqrec_breakdown, - safely_connect, - search_and_cache, - searchterm_gen, seeds_blast, - seq_download, seqarc_gen, - seqrec_augment, - seqrec_convert, seqrec_gen, - seqrec_get, sids_check, - sids_get, sids_load, - sids_save, sqs_count, - sqs_save, stage_args_check, - stages_run, tax_download, - taxdict_gen, taxtree_gen, - txids_get, txnds_count

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/write_phylota.html b/docs/reference/write_phylota.html deleted file mode 100644 index d247d78..0000000 --- a/docs/reference/write_phylota.html +++ /dev/null @@ -1,188 +0,0 @@ - - - - - - - - -Write out PhyLoTa-like Table — write_phylota • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Write out PhyLoTa-like Table

    - Source: R/user-special.R - -
    - -
    - -

    Create a PhyLoTa-like table from phylota object.

    - -
    - - 
    write_table(phylota, outfile)
    - -

    Arguments

    - - - - - - - - - - -
    phylota

    Phylota

    outfile

    Output file

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_cls, drop_sqs, - get_clstr_slot, get_nsqs, - get_ntaxa, get_sq_slot, - get_tx_slot, get_txids, - is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota, write_sqs

    - - -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown.

    -
    - -
    -
    - - - - - - diff --git a/docs/reference/write_sqs.html b/docs/reference/write_sqs.html deleted file mode 100644 index b8a7e37..0000000 --- a/docs/reference/write_sqs.html +++ /dev/null @@ -1,211 +0,0 @@ - - - - - - - - -Write out sequences — write_sqs • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Write out sequences

    - Source: R/user-special.R - -
    - -
    - -

    Write out sequences, as .fasta, for a given vector of IDs.

    - -
    - - 
    write_sqs(phylota, outfile, sid, sq_nm = sid, width = 80)
    - -

    Arguments

    - - - - - - - - - - - - - - - - - - - - - - -
    phylota

    Phylota

    outfile

    Output file

    sid

    Sequence ID(s)

    sq_nm

    Sequence name(s)

    width

    Maximum number of characters in a line, integer

    - -

    Details

    - -

    The user can control the output definition lines of the sequences using the -sq_nm. By default sequences IDs are used. Note, ensure the sq_nm are in the -same order as sid.

    - -

    See also

    - -

    Other tools-public: calc_mad, - calc_wrdfrq, drop_by_rank, - drop_clstrs, drop_sqs, - get_clstr_slot, get_nsqs, - get_ntaxa, get_sq_slot, - get_stage_times, get_tx_slot, - get_txids, is_txid_in_clstr, - is_txid_in_sq, - list_clstrrec_slots, - list_ncbi_ranks, - list_seqrec_slots, - list_taxrec_slots, - plot_phylota_pa, - plot_phylota_treemap, - read_phylota

    - - -

    Examples

    - 
    data('aotus')
-# get sequences for a cluster and write out
-random_cid <- sample(aotus@cids, 1)
-sids <- aotus[[random_cid]]@sids
-write_sqs(phylota = aotus, outfile = file.path(tempdir(), 'test.fasta'),
-          sq_nm = 'my_gene', sid = sids)
    -
    - -
    - -
    -
    -

    Developed by Hannes Hettling, Rutger Vos, Alexander Zizka, Dom Bennett, Alexandre Antonelli.

    -
    - -
    -

    Site built with pkgdown 1.2.0.9000.

    -
    -
    -
    - - - - - - diff --git a/docs/reference/yeasts.rd b/docs/reference/yeasts.rd deleted file mode 100644 index bab61b6..0000000 --- a/docs/reference/yeasts.rd +++ /dev/null @@ -1,163 +0,0 @@ - - - - - - - - -Example phylota object (yeasts) — yeasts • phylotaR - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
    -
    - - - -
    - -
    -
    -
    -

    Example phylota object (yeasts)

    - - -
    - -
    - -

    Final phylota object produced by running pipeline for the yeasts, Kazachstania (71245).

    - -
    - - 
    data(yeasts)
    - -

    Format

    - -

    yeasts is generated from read_phylota().

    - - -

    Examples

    - 
    data(yeasts) # load object
-str(yeasts)
    #> Formal class 'Phylota' [package "phylotaR"] with 8 slots
-#>   ..@ cids   : chr [1:92] "0" "1" "2" "3" ...
-#>   ..@ txids  : chr [1:40] "1789685" "1789683" "1734212" "1392788" ...
-#>   ..@ sids   : chr [1:593] "LT158256.1" "LT158255.1" "LT158253.1" "LT158252.1" ...
-#>   ..@ txdct  :Formal class 'TaxDict' [package "phylotaR"] with 4 slots
-#>   ..@ sqs    :Formal class 'SeqArc' [package "phylotaR"] with 5 slots
-#>   ..@ clstrs :Formal class 'ClstrArc' [package "phylotaR"] with 2 slots
-#>   ..@ prnt_id: chr "71245"
-#>   ..@ prnt_nm: chr "Kazachstania"
    -
    - -
    - - -
    - - - - - -