-
Notifications
You must be signed in to change notification settings - Fork 1
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge pull request #65 from gregdenay/master
Fix for `trim_primers_3end` parameter and primer sequences containing ambiguous nucleotides
- Loading branch information
Showing
23 changed files
with
273 additions
and
151 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,3 @@ | ||
[flake8] | ||
max-line-length = 120 | ||
extend-ignore = E203, F821, E402 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,36 @@ | ||
--- | ||
########################### | ||
########################### | ||
## Markdown Linter rules ## | ||
########################### | ||
########################### | ||
|
||
# Linter rules doc: | ||
# - https://github.com/DavidAnson/markdownlint | ||
# | ||
# Note: | ||
# To comment out a single error: | ||
# <!-- markdownlint-disable --> | ||
# any violations you want | ||
# <!-- markdownlint-restore --> | ||
# | ||
|
||
############### | ||
# Rules by id # | ||
############### | ||
MD004: false # Unordered list style | ||
MD007: | ||
indent: 2 # Unordered list indentation | ||
MD013: | ||
line_length: 400 # Line length 80 is far to short | ||
MD026: | ||
punctuation: ".,;:!。,;:" # List of not allowed | ||
MD029: false # Ordered list item prefix | ||
MD033: false # Allow inline HTML | ||
MD036: false # Emphasis used instead of a heading | ||
MD041: false # First line in a file should be a top-level heading | ||
|
||
################# | ||
# Rules by tags # | ||
################# | ||
blank_lines: false # Error on blank lines |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
|
@@ -12,34 +12,28 @@ on: | |
jobs: | ||
formatting: | ||
runs-on: ubuntu-latest | ||
permissions: | ||
contents: read | ||
packages: read | ||
statuses: write | ||
|
||
steps: | ||
|
||
- name: Checkout Code | ||
uses: actions/checkout@v2 | ||
uses: actions/checkout@v3 | ||
with: | ||
fetch-depth: 0 | ||
|
||
- name: Lint | ||
uses: github/super-linter@v4 | ||
uses: github/super-linter@v5 | ||
env: | ||
VALIDATE_ALL_CODEBASE: false | ||
VALIDATE_ALL_CODEBASE: true | ||
DEFAULT_BRANCH: master | ||
GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} | ||
VALIDATE_SNAKEMAKE_SNAKEFMT: true | ||
VALIDATE_PYTHON_FLAKE8: true | ||
VALIDATE_R: true | ||
|
||
# jobs: | ||
# formatting: | ||
# runs-on: ubuntu-latest | ||
# steps: | ||
# - uses: actions/checkout@v2 | ||
# - name: Checkout code | ||
# uses: textbook/[email protected] | ||
# - name: Formatting | ||
# uses: github/super-linter@v4 | ||
# env: | ||
# VALIDATE_ALL_CODEBASE: false | ||
# DEFAULT_BRANCH: master | ||
# GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} | ||
# VALIDATE_SNAKEMAKE_SNAKEFMT: true | ||
|
||
linting: | ||
runs-on: ubuntu-latest | ||
steps: | ||
|
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,8 +1,6 @@ | ||
>FwdM | ||
GACGAGAAGACCCTATGGAGC | ||
>RevM | ||
TCCGAGGTCACCCCAACC | ||
>FwdP | ||
GACGAGAAGACCCTGTGGAAC | ||
>RevP | ||
TCCAAGGTCGCCCCAACC | ||
>Rev | ||
TCCGAGGTCRCCCCAACC |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1 +1 @@ | ||
1.6.5 | ||
1.6.6 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
|
@@ -3,4 +3,5 @@ channels: | |
- conda-forge | ||
dependencies: | ||
- pandas=1.4.2 | ||
- scikit-learn=1.1.1 | ||
- scikit-learn=1.1.1 | ||
- biopython=1.81 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Oops, something went wrong.