Skip to content

Commit

Permalink
Merge pull request #282 from leexgh/add-IGR
Browse files Browse the repository at this point in the history 
Add consequence for IGR variants
  • Loading branch information
@leexgh
leexgh authored Oct 11, 2024
2 parents 188dac0 + 5a960ff commit 6a75b2e
Show file tree
Hide file tree
Showing 5 changed files with 25 additions and 10 deletions.
2 changes: 1 addition & 1 deletion annotationPipeline/src/test/resources/expected/vcf2maf_tests.mskcc.txt
View file
Original file line number Diff line number Diff line change
Expand Up @@ -3,7 +3,7 @@
#version 2.4
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number genomic_location_explanation n_depth t_depth Annotation_Status
MTOR 2475 . GRCh37 1 11290179 11290179 + intron_variant Intron DEL A A - rs35067541 TUMOR NORMAL A A 10 10 30 5 ENST00000361445.4:c.2779+803del p.*927* ENST00000361445 NM_004958.3 35 20 SUCCESS
Unknown 0 . GRCh37 1 15557977 15557978 + IGR DNP TG TG CA TUMOR NORMAL TG TG 11 5 21 1 22 16 SUCCESS
Unknown 0 . GRCh37 1 15557977 15557978 + intergenic_variant IGR DNP TG TG CA TUMOR NORMAL TG TG 11 5 21 1 22 16 SUCCESS
CHD1L 9557 . GRCh37 1 146728217 146728217 + splice_donor_variant Splice_Site SNP G G A rs942221386 TUMOR NORMAL G G 19 21 42 0 ENST00000369258.4:c.494+1G>A p.X165_splice ENST00000369258 NM_001256336.1 165 42 40 SUCCESS
INHA 3623 . GRCh37 2 220439700 220439701 + frameshift_variant Frame_Shift_Ins INS - - CT TUMOR NORMAL - - 21 72 51 0 ENST00000243786.2:c.562_563dup p.Leu189CysfsTer2 p.L189Cfs*2 ENST00000243786 NM_002191.3 185 gct/gCTct 2/2 51 93 SUCCESS
BAP1 8314 . GRCh37 3 52437427 52437448 + splice_donor_variant,coding_sequence_variant,intron_variant Splice_Site DEL CCCACCTGTCAGCGCCAGGGGA CCCACCTGTCAGCGCCAGGGGA - TUMOR NORMAL CCCACCTGTCAGCGCCAGGGGA CCCACCTGTCAGCGCCAGGGGA 10 10 11 0 ENST00000460680.1:c.1713_1729+5del p.X571_splice ENST00000460680 NM_004656.3 571 13/17 11 20 SUCCESS
Expand Down
2 changes: 1 addition & 1 deletion annotationPipeline/src/test/resources/expected/vcf2maf_tests.uniprot.txt
View file
Original file line number Diff line number Diff line change
Expand Up @@ -3,7 +3,7 @@
#version 2.4
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number genomic_location_explanation n_depth t_depth Annotation_Status
MTOR 2475 . GRCh37 1 11290179 11290179 + intron_variant Intron DEL A A - rs35067541 TUMOR NORMAL A A 10 10 30 5 ENST00000361445.4:c.2779+803del p.*927* ENST00000361445 NM_004958.3 35 20 SUCCESS
Unknown 0 . GRCh37 1 15557977 15557978 + IGR DNP TG TG CA TUMOR NORMAL TG TG 11 5 21 1 22 16 SUCCESS
Unknown 0 . GRCh37 1 15557977 15557978 + intergenic_variant IGR DNP TG TG CA TUMOR NORMAL TG TG 11 5 21 1 22 16 SUCCESS
CHD1L 9557 . GRCh37 1 146728217 146728217 + splice_donor_variant Splice_Site SNP G G A rs942221386 TUMOR NORMAL G G 19 21 42 0 ENST00000369258.4:c.494+1G>A p.X165_splice ENST00000369258 NM_001256336.1 165 42 40 SUCCESS
INHA 3623 . GRCh37 2 220439700 220439701 + frameshift_variant Frame_Shift_Ins INS - - CT TUMOR NORMAL - - 21 72 51 0 ENST00000243786.2:c.562_563dup p.Leu189CysfsTer2 p.L189Cfs*2 ENST00000243786 NM_002191.3 185 gct/gCTct 2/2 51 93 SUCCESS
BAP1 8314 . GRCh37 3 52437427 52437448 + splice_donor_variant,coding_sequence_variant,intron_variant Splice_Site DEL CCCACCTGTCAGCGCCAGGGGA CCCACCTGTCAGCGCCAGGGGA - TUMOR NORMAL CCCACCTGTCAGCGCCAGGGGA CCCACCTGTCAGCGCCAGGGGA 10 10 11 0 ENST00000460680.1:c.1713_1729+5del p.X571_splice ENST00000460680 NM_004656.3 571 13/17 11 20 SUCCESS
Expand Down
4 changes: 2 additions & 2 deletions annotator/src/main/java/org/cbioportal/annotator/internal/GenomeNexusImpl.java
View file
Original file line number Diff line number Diff line change
Expand Up @@ -367,7 +367,7 @@ else if (stripMatchingBases.equals("first")) {
resolvedStartPosition,
annotationUtil.resolveEnd(gnResponse, mRecord),
annotationUtil.resolveStrandSign(gnResponse, mRecord),
annotationUtil.resolveVariantClassification(canonicalTranscript, mRecord),
annotationUtil.resolveVariantClassification(gnResponse, canonicalTranscript, mRecord),
annotationUtil.resolveVariantType(gnResponse),
resolvedReferenceAllele,
resolvedTumorSeqAllele1,
Expand Down Expand Up @@ -406,7 +406,7 @@ else if (stripMatchingBases.equals("first")) {
annotationUtil.resolveProteinPosEnd(canonicalTranscript),
annotationUtil.resolveCodonChange(canonicalTranscript),
annotationUtil.resolveHotspot(),
annotationUtil.resolveConsequence(canonicalTranscript),
annotationUtil.resolveConsequence(gnResponse, canonicalTranscript),
annotationUtil.resolveProteinPosition(canonicalTranscript, mRecord),
annotationUtil.resolveExon(canonicalTranscript),
mRecord.getAdditionalProperties());
Expand Down
25 changes: 20 additions & 5 deletions annotator/src/main/java/org/cbioportal/annotator/util/AnnotationUtil.java
View file
Original file line number Diff line number Diff line change
Expand Up @@ -331,11 +331,15 @@ public String resolveHgvspShort(TranscriptConsequenceSummary canonicalTranscript
return hgvsp;
}

public String resolveConsequence(TranscriptConsequenceSummary canonicalTranscript) {
if (canonicalTranscript == null || canonicalTranscript.getConsequenceTerms() == null) {
return "";
} else {
public String resolveConsequence(VariantAnnotation gnResponse, TranscriptConsequenceSummary canonicalTranscript) {
if (canonicalTranscript != null && canonicalTranscript.getConsequenceTerms() != null) {
return canonicalTranscript.getConsequenceTerms();
} else if (hasIntergenicConsequenceSummaries(gnResponse)) {
// for most cases there is only one intergenic consequence in the list, so we use first intergenic consequence here
// but multiple intergenic consequences are possible, maybe we need to handle this case in the future
return String.join(",", gnResponse.getAnnotationSummary().getIntergenicConsequenceSummaries().get(0).getConsequenceTerms());
} else {
return "";
}
}

Expand All @@ -356,10 +360,14 @@ public String resolveEnd(VariantAnnotation gnResponse, MutationRecord mRecord) {

}

public String resolveVariantClassification(TranscriptConsequenceSummary canonicalTranscript, MutationRecord mRecord) {
public String resolveVariantClassification(VariantAnnotation gnResponse, TranscriptConsequenceSummary canonicalTranscript, MutationRecord mRecord) {
String variantClassification = null;
if (canonicalTranscript != null) {
variantClassification = canonicalTranscript.getVariantClassification();
} else if (hasIntergenicConsequenceSummaries(gnResponse)) {
// for most cases there is only one intergenic consequence in the list, so we use first intergenic consequence here
// but multiple intergenic consequences are possible, maybe we need to handle this case in the future
variantClassification = gnResponse.getAnnotationSummary().getIntergenicConsequenceSummaries().get(0).getVariantClassification();
}
return variantClassification != null ? variantClassification : mRecord.getVARIANT_CLASSIFICATION();
}
Expand Down Expand Up @@ -535,4 +543,11 @@ private String parseIntegerAsString(Integer value) {
return value != null ? String.valueOf(value) : "";
}

private boolean hasIntergenicConsequenceSummaries(VariantAnnotation gnResponse) {
return gnResponse != null &&
gnResponse.getAnnotationSummary() != null &&
gnResponse.getAnnotationSummary().getIntergenicConsequenceSummaries() != null &&
!gnResponse.getAnnotationSummary().getIntergenicConsequenceSummaries().isEmpty();
}

}
2 changes: 1 addition & 1 deletion annotator/src/test/java/org/cbioportal/models/MutationRecordTest.java
View file
Original file line number Diff line number Diff line change
Expand Up @@ -30,7 +30,7 @@
* along with this program. If not, see <http://www.gnu.org/licenses/>.
*/

package org.cbioportal.model;
package org.cbioportal.models;

import java.lang.reflect.InvocationTargetException;
import java.lang.reflect.Method;
Expand Down

0 comments on commit 6a75b2e

Please sign in to comment.